ID: 985323303

View in Genome Browser
Species Human (GRCh38)
Location 4:188738512-188738534
Sequence AAGCCCATTTGAAGGTCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985323300_985323303 -9 Left 985323300 4:188738498-188738520 CCAGGCGGGGTCTGAAGCCCATT No data
Right 985323303 4:188738512-188738534 AAGCCCATTTGAAGGTCAGGAGG No data
985323290_985323303 25 Left 985323290 4:188738464-188738486 CCCGGGGCGGGCCCTTGCGGACC No data
Right 985323303 4:188738512-188738534 AAGCCCATTTGAAGGTCAGGAGG No data
985323297_985323303 4 Left 985323297 4:188738485-188738507 CCTTCCTCGAGCGCCAGGCGGGG No data
Right 985323303 4:188738512-188738534 AAGCCCATTTGAAGGTCAGGAGG No data
985323291_985323303 24 Left 985323291 4:188738465-188738487 CCGGGGCGGGCCCTTGCGGACCT No data
Right 985323303 4:188738512-188738534 AAGCCCATTTGAAGGTCAGGAGG No data
985323292_985323303 14 Left 985323292 4:188738475-188738497 CCCTTGCGGACCTTCCTCGAGCG No data
Right 985323303 4:188738512-188738534 AAGCCCATTTGAAGGTCAGGAGG No data
985323293_985323303 13 Left 985323293 4:188738476-188738498 CCTTGCGGACCTTCCTCGAGCGC No data
Right 985323303 4:188738512-188738534 AAGCCCATTTGAAGGTCAGGAGG No data
985323299_985323303 0 Left 985323299 4:188738489-188738511 CCTCGAGCGCCAGGCGGGGTCTG No data
Right 985323303 4:188738512-188738534 AAGCCCATTTGAAGGTCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985323303 Original CRISPR AAGCCCATTTGAAGGTCAGG AGG Intergenic