ID: 985323304

View in Genome Browser
Species Human (GRCh38)
Location 4:188738515-188738537
Sequence GGGCCTCCTGACCTTCAAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985323304_985323312 28 Left 985323304 4:188738515-188738537 CCCATTTGAAGGTCAGGAGGCCC No data
Right 985323312 4:188738566-188738588 ACGAGAAGGAGCAGGAGCTGCGG No data
985323304_985323313 29 Left 985323304 4:188738515-188738537 CCCATTTGAAGGTCAGGAGGCCC No data
Right 985323313 4:188738567-188738589 CGAGAAGGAGCAGGAGCTGCGGG No data
985323304_985323310 14 Left 985323304 4:188738515-188738537 CCCATTTGAAGGTCAGGAGGCCC No data
Right 985323310 4:188738552-188738574 GATCAAACTGCTGAACGAGAAGG No data
985323304_985323311 20 Left 985323304 4:188738515-188738537 CCCATTTGAAGGTCAGGAGGCCC No data
Right 985323311 4:188738558-188738580 ACTGCTGAACGAGAAGGAGCAGG No data
985323304_985323307 -10 Left 985323304 4:188738515-188738537 CCCATTTGAAGGTCAGGAGGCCC No data
Right 985323307 4:188738528-188738550 CAGGAGGCCCGAGTTGCTGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985323304 Original CRISPR GGGCCTCCTGACCTTCAAAT GGG (reversed) Intergenic