ID: 985323306

View in Genome Browser
Species Human (GRCh38)
Location 4:188738525-188738547
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985323299_985323306 13 Left 985323299 4:188738489-188738511 CCTCGAGCGCCAGGCGGGGTCTG No data
Right 985323306 4:188738525-188738547 GGTCAGGAGGCCCGAGTTGCTGG No data
985323292_985323306 27 Left 985323292 4:188738475-188738497 CCCTTGCGGACCTTCCTCGAGCG No data
Right 985323306 4:188738525-188738547 GGTCAGGAGGCCCGAGTTGCTGG No data
985323297_985323306 17 Left 985323297 4:188738485-188738507 CCTTCCTCGAGCGCCAGGCGGGG No data
Right 985323306 4:188738525-188738547 GGTCAGGAGGCCCGAGTTGCTGG No data
985323293_985323306 26 Left 985323293 4:188738476-188738498 CCTTGCGGACCTTCCTCGAGCGC No data
Right 985323306 4:188738525-188738547 GGTCAGGAGGCCCGAGTTGCTGG No data
985323300_985323306 4 Left 985323300 4:188738498-188738520 CCAGGCGGGGTCTGAAGCCCATT No data
Right 985323306 4:188738525-188738547 GGTCAGGAGGCCCGAGTTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr