ID: 985323307

View in Genome Browser
Species Human (GRCh38)
Location 4:188738528-188738550
Sequence CAGGAGGCCCGAGTTGCTGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985323299_985323307 16 Left 985323299 4:188738489-188738511 CCTCGAGCGCCAGGCGGGGTCTG No data
Right 985323307 4:188738528-188738550 CAGGAGGCCCGAGTTGCTGGCGG No data
985323292_985323307 30 Left 985323292 4:188738475-188738497 CCCTTGCGGACCTTCCTCGAGCG No data
Right 985323307 4:188738528-188738550 CAGGAGGCCCGAGTTGCTGGCGG No data
985323297_985323307 20 Left 985323297 4:188738485-188738507 CCTTCCTCGAGCGCCAGGCGGGG No data
Right 985323307 4:188738528-188738550 CAGGAGGCCCGAGTTGCTGGCGG No data
985323293_985323307 29 Left 985323293 4:188738476-188738498 CCTTGCGGACCTTCCTCGAGCGC No data
Right 985323307 4:188738528-188738550 CAGGAGGCCCGAGTTGCTGGCGG No data
985323304_985323307 -10 Left 985323304 4:188738515-188738537 CCCATTTGAAGGTCAGGAGGCCC No data
Right 985323307 4:188738528-188738550 CAGGAGGCCCGAGTTGCTGGCGG No data
985323300_985323307 7 Left 985323300 4:188738498-188738520 CCAGGCGGGGTCTGAAGCCCATT No data
Right 985323307 4:188738528-188738550 CAGGAGGCCCGAGTTGCTGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985323307 Original CRISPR CAGGAGGCCCGAGTTGCTGG CGG Intergenic