ID: 985323475

View in Genome Browser
Species Human (GRCh38)
Location 4:188740516-188740538
Sequence AACACAAGCCAATCCTTTTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985323475_985323476 10 Left 985323475 4:188740516-188740538 CCTTAAAAGGATTGGCTTGTGTT No data
Right 985323476 4:188740549-188740571 AGTCTAACAAGTCCAAAAGCTGG No data
985323475_985323481 30 Left 985323475 4:188740516-188740538 CCTTAAAAGGATTGGCTTGTGTT No data
Right 985323481 4:188740569-188740591 TGGAGTGTGAGGCAGGAGGCTGG No data
985323475_985323480 26 Left 985323475 4:188740516-188740538 CCTTAAAAGGATTGGCTTGTGTT No data
Right 985323480 4:188740565-188740587 AAGCTGGAGTGTGAGGCAGGAGG No data
985323475_985323477 19 Left 985323475 4:188740516-188740538 CCTTAAAAGGATTGGCTTGTGTT No data
Right 985323477 4:188740558-188740580 AGTCCAAAAGCTGGAGTGTGAGG No data
985323475_985323479 23 Left 985323475 4:188740516-188740538 CCTTAAAAGGATTGGCTTGTGTT No data
Right 985323479 4:188740562-188740584 CAAAAGCTGGAGTGTGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985323475 Original CRISPR AACACAAGCCAATCCTTTTA AGG (reversed) Intergenic
No off target data available for this crispr