ID: 985323476

View in Genome Browser
Species Human (GRCh38)
Location 4:188740549-188740571
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985323473_985323476 22 Left 985323473 4:188740504-188740526 CCAGACAAACTTCCTTAAAAGGA No data
Right 985323476 4:188740549-188740571 AGTCTAACAAGTCCAAAAGCTGG No data
985323475_985323476 10 Left 985323475 4:188740516-188740538 CCTTAAAAGGATTGGCTTGTGTT No data
Right 985323476 4:188740549-188740571 AGTCTAACAAGTCCAAAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr