ID: 985327724

View in Genome Browser
Species Human (GRCh38)
Location 4:188791040-188791062
Sequence CAGGTTATCCATAGGGACAC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985327713_985327724 29 Left 985327713 4:188790988-188791010 CCTTTCAACATCTTAATTAATAT No data
Right 985327724 4:188791040-188791062 CAGGTTATCCATAGGGACACGGG No data
985327716_985327724 2 Left 985327716 4:188791015-188791037 CCATTAACTGAAACCTGGCCCTT No data
Right 985327724 4:188791040-188791062 CAGGTTATCCATAGGGACACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985327724 Original CRISPR CAGGTTATCCATAGGGACAC GGG Intergenic
No off target data available for this crispr