ID: 985331750

View in Genome Browser
Species Human (GRCh38)
Location 4:188844902-188844924
Sequence GGCTGTTTGTTGCAGTAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985331750_985331759 16 Left 985331750 4:188844902-188844924 CCATTCTACTGCAACAAACAGCC No data
Right 985331759 4:188844941-188844963 TTATTTATTCATTATTAATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985331750 Original CRISPR GGCTGTTTGTTGCAGTAGAA TGG (reversed) Intergenic
No off target data available for this crispr