ID: 985334860

View in Genome Browser
Species Human (GRCh38)
Location 4:188881378-188881400
Sequence CACTGGCCAATTCCACTGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985334860_985334867 26 Left 985334860 4:188881378-188881400 CCTCACAGTGGAATTGGCCAGTG No data
Right 985334867 4:188881427-188881449 TAATATTTACAAGTATTTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985334860 Original CRISPR CACTGGCCAATTCCACTGTG AGG (reversed) Intergenic
No off target data available for this crispr