ID: 985336870

View in Genome Browser
Species Human (GRCh38)
Location 4:188905483-188905505
Sequence GGTTATGCACAGAGGGCGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985336870_985336878 -8 Left 985336870 4:188905483-188905505 CCATCCGCCCTCTGTGCATAACC No data
Right 985336878 4:188905498-188905520 GCATAACCTGGGGGTACAACAGG No data
985336870_985336881 29 Left 985336870 4:188905483-188905505 CCATCCGCCCTCTGTGCATAACC No data
Right 985336881 4:188905535-188905557 TCAGTTGTGCTTCCGTGTCCCGG No data
985336870_985336882 30 Left 985336870 4:188905483-188905505 CCATCCGCCCTCTGTGCATAACC No data
Right 985336882 4:188905536-188905558 CAGTTGTGCTTCCGTGTCCCGGG No data
985336870_985336880 4 Left 985336870 4:188905483-188905505 CCATCCGCCCTCTGTGCATAACC No data
Right 985336880 4:188905510-188905532 GGTACAACAGGCTCGCGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985336870 Original CRISPR GGTTATGCACAGAGGGCGGA TGG (reversed) Intergenic
No off target data available for this crispr