ID: 985342160

View in Genome Browser
Species Human (GRCh38)
Location 4:188966253-188966275
Sequence TCATCAATACGTAAGAAACT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985342160_985342162 25 Left 985342160 4:188966253-188966275 CCTAGTTTCTTACGTATTGATGA No data
Right 985342162 4:188966301-188966323 AAATACATTGCAGACTCTAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985342160 Original CRISPR TCATCAATACGTAAGAAACT AGG (reversed) Intergenic
No off target data available for this crispr