ID: 985343487

View in Genome Browser
Species Human (GRCh38)
Location 4:188976094-188976116
Sequence TCTTATATTTTGCTGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985343487_985343492 3 Left 985343487 4:188976094-188976116 CCTTCCACCAGCAAAATATAAGA No data
Right 985343492 4:188976120-188976142 GCTTAGTCTGTATCGTTTTTTGG No data
985343487_985343493 20 Left 985343487 4:188976094-188976116 CCTTCCACCAGCAAAATATAAGA No data
Right 985343493 4:188976137-188976159 TTTTGGTGACATAAACAGAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985343487 Original CRISPR TCTTATATTTTGCTGGTGGA AGG (reversed) Intergenic
No off target data available for this crispr