ID: 985348678

View in Genome Browser
Species Human (GRCh38)
Location 4:189035117-189035139
Sequence GGTTTAAAGGAAGCCAGTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985348678_985348682 10 Left 985348678 4:189035117-189035139 CCTGCACTGGCTTCCTTTAAACC No data
Right 985348682 4:189035150-189035172 AATCCTCCTTGCGGAAGACGCGG No data
985348678_985348683 11 Left 985348678 4:189035117-189035139 CCTGCACTGGCTTCCTTTAAACC No data
Right 985348683 4:189035151-189035173 ATCCTCCTTGCGGAAGACGCGGG No data
985348678_985348681 1 Left 985348678 4:189035117-189035139 CCTGCACTGGCTTCCTTTAAACC No data
Right 985348681 4:189035141-189035163 ATAAATCAAAATCCTCCTTGCGG No data
985348678_985348686 21 Left 985348678 4:189035117-189035139 CCTGCACTGGCTTCCTTTAAACC No data
Right 985348686 4:189035161-189035183 CGGAAGACGCGGGTTTCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985348678 Original CRISPR GGTTTAAAGGAAGCCAGTGC AGG (reversed) Intergenic
No off target data available for this crispr