ID: 985348679

View in Genome Browser
Species Human (GRCh38)
Location 4:189035130-189035152
Sequence ATTTTGATTTATTGGTTTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985348679_985348687 21 Left 985348679 4:189035130-189035152 CCTTTAAACCAATAAATCAAAAT No data
Right 985348687 4:189035174-189035196 TTTCCACAGGCAGCTCCCCGTGG No data
985348679_985348690 25 Left 985348679 4:189035130-189035152 CCTTTAAACCAATAAATCAAAAT No data
Right 985348690 4:189035178-189035200 CACAGGCAGCTCCCCGTGGAGGG No data
985348679_985348682 -3 Left 985348679 4:189035130-189035152 CCTTTAAACCAATAAATCAAAAT No data
Right 985348682 4:189035150-189035172 AATCCTCCTTGCGGAAGACGCGG No data
985348679_985348686 8 Left 985348679 4:189035130-189035152 CCTTTAAACCAATAAATCAAAAT No data
Right 985348686 4:189035161-189035183 CGGAAGACGCGGGTTTCCACAGG No data
985348679_985348689 24 Left 985348679 4:189035130-189035152 CCTTTAAACCAATAAATCAAAAT No data
Right 985348689 4:189035177-189035199 CCACAGGCAGCTCCCCGTGGAGG No data
985348679_985348683 -2 Left 985348679 4:189035130-189035152 CCTTTAAACCAATAAATCAAAAT No data
Right 985348683 4:189035151-189035173 ATCCTCCTTGCGGAAGACGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985348679 Original CRISPR ATTTTGATTTATTGGTTTAA AGG (reversed) Intergenic