ID: 985348680

View in Genome Browser
Species Human (GRCh38)
Location 4:189035138-189035160
Sequence CAAGGAGGATTTTGATTTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985348680_985348690 17 Left 985348680 4:189035138-189035160 CCAATAAATCAAAATCCTCCTTG No data
Right 985348690 4:189035178-189035200 CACAGGCAGCTCCCCGTGGAGGG No data
985348680_985348686 0 Left 985348680 4:189035138-189035160 CCAATAAATCAAAATCCTCCTTG No data
Right 985348686 4:189035161-189035183 CGGAAGACGCGGGTTTCCACAGG No data
985348680_985348687 13 Left 985348680 4:189035138-189035160 CCAATAAATCAAAATCCTCCTTG No data
Right 985348687 4:189035174-189035196 TTTCCACAGGCAGCTCCCCGTGG No data
985348680_985348683 -10 Left 985348680 4:189035138-189035160 CCAATAAATCAAAATCCTCCTTG No data
Right 985348683 4:189035151-189035173 ATCCTCCTTGCGGAAGACGCGGG No data
985348680_985348689 16 Left 985348680 4:189035138-189035160 CCAATAAATCAAAATCCTCCTTG No data
Right 985348689 4:189035177-189035199 CCACAGGCAGCTCCCCGTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985348680 Original CRISPR CAAGGAGGATTTTGATTTAT TGG (reversed) Intergenic
No off target data available for this crispr