ID: 985348682

View in Genome Browser
Species Human (GRCh38)
Location 4:189035150-189035172
Sequence AATCCTCCTTGCGGAAGACG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985348679_985348682 -3 Left 985348679 4:189035130-189035152 CCTTTAAACCAATAAATCAAAAT No data
Right 985348682 4:189035150-189035172 AATCCTCCTTGCGGAAGACGCGG No data
985348678_985348682 10 Left 985348678 4:189035117-189035139 CCTGCACTGGCTTCCTTTAAACC No data
Right 985348682 4:189035150-189035172 AATCCTCCTTGCGGAAGACGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985348682 Original CRISPR AATCCTCCTTGCGGAAGACG CGG Intergenic