ID: 985348686

View in Genome Browser
Species Human (GRCh38)
Location 4:189035161-189035183
Sequence CGGAAGACGCGGGTTTCCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985348678_985348686 21 Left 985348678 4:189035117-189035139 CCTGCACTGGCTTCCTTTAAACC No data
Right 985348686 4:189035161-189035183 CGGAAGACGCGGGTTTCCACAGG No data
985348679_985348686 8 Left 985348679 4:189035130-189035152 CCTTTAAACCAATAAATCAAAAT No data
Right 985348686 4:189035161-189035183 CGGAAGACGCGGGTTTCCACAGG No data
985348680_985348686 0 Left 985348680 4:189035138-189035160 CCAATAAATCAAAATCCTCCTTG No data
Right 985348686 4:189035161-189035183 CGGAAGACGCGGGTTTCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985348686 Original CRISPR CGGAAGACGCGGGTTTCCAC AGG Intergenic
No off target data available for this crispr