ID: 985348687

View in Genome Browser
Species Human (GRCh38)
Location 4:189035174-189035196
Sequence TTTCCACAGGCAGCTCCCCG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985348679_985348687 21 Left 985348679 4:189035130-189035152 CCTTTAAACCAATAAATCAAAAT No data
Right 985348687 4:189035174-189035196 TTTCCACAGGCAGCTCCCCGTGG No data
985348685_985348687 -5 Left 985348685 4:189035156-189035178 CCTTGCGGAAGACGCGGGTTTCC No data
Right 985348687 4:189035174-189035196 TTTCCACAGGCAGCTCCCCGTGG No data
985348684_985348687 -2 Left 985348684 4:189035153-189035175 CCTCCTTGCGGAAGACGCGGGTT No data
Right 985348687 4:189035174-189035196 TTTCCACAGGCAGCTCCCCGTGG No data
985348680_985348687 13 Left 985348680 4:189035138-189035160 CCAATAAATCAAAATCCTCCTTG No data
Right 985348687 4:189035174-189035196 TTTCCACAGGCAGCTCCCCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985348687 Original CRISPR TTTCCACAGGCAGCTCCCCG TGG Intergenic