ID: 985348690

View in Genome Browser
Species Human (GRCh38)
Location 4:189035178-189035200
Sequence CACAGGCAGCTCCCCGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985348684_985348690 2 Left 985348684 4:189035153-189035175 CCTCCTTGCGGAAGACGCGGGTT No data
Right 985348690 4:189035178-189035200 CACAGGCAGCTCCCCGTGGAGGG No data
985348679_985348690 25 Left 985348679 4:189035130-189035152 CCTTTAAACCAATAAATCAAAAT No data
Right 985348690 4:189035178-189035200 CACAGGCAGCTCCCCGTGGAGGG No data
985348685_985348690 -1 Left 985348685 4:189035156-189035178 CCTTGCGGAAGACGCGGGTTTCC No data
Right 985348690 4:189035178-189035200 CACAGGCAGCTCCCCGTGGAGGG No data
985348680_985348690 17 Left 985348680 4:189035138-189035160 CCAATAAATCAAAATCCTCCTTG No data
Right 985348690 4:189035178-189035200 CACAGGCAGCTCCCCGTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985348690 Original CRISPR CACAGGCAGCTCCCCGTGGA GGG Intergenic