ID: 985350732

View in Genome Browser
Species Human (GRCh38)
Location 4:189058649-189058671
Sequence ACGACAGACAACAGCGGTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985350732_985350742 14 Left 985350732 4:189058649-189058671 CCACCACCGCTGTTGTCTGTCGT No data
Right 985350742 4:189058686-189058708 TGACTTCTCCCCTCCGGATCTGG No data
985350732_985350739 8 Left 985350732 4:189058649-189058671 CCACCACCGCTGTTGTCTGTCGT No data
Right 985350739 4:189058680-189058702 CTCCCTTGACTTCTCCCCTCCGG No data
985350732_985350743 18 Left 985350732 4:189058649-189058671 CCACCACCGCTGTTGTCTGTCGT No data
Right 985350743 4:189058690-189058712 TTCTCCCCTCCGGATCTGGCAGG No data
985350732_985350744 19 Left 985350732 4:189058649-189058671 CCACCACCGCTGTTGTCTGTCGT No data
Right 985350744 4:189058691-189058713 TCTCCCCTCCGGATCTGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985350732 Original CRISPR ACGACAGACAACAGCGGTGG TGG (reversed) Intergenic
No off target data available for this crispr