ID: 985350734

View in Genome Browser
Species Human (GRCh38)
Location 4:189058655-189058677
Sequence TCTGGGACGACAGACAACAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985350734_985350742 8 Left 985350734 4:189058655-189058677 CCGCTGTTGTCTGTCGTCCCAGA No data
Right 985350742 4:189058686-189058708 TGACTTCTCCCCTCCGGATCTGG No data
985350734_985350744 13 Left 985350734 4:189058655-189058677 CCGCTGTTGTCTGTCGTCCCAGA No data
Right 985350744 4:189058691-189058713 TCTCCCCTCCGGATCTGGCAGGG No data
985350734_985350739 2 Left 985350734 4:189058655-189058677 CCGCTGTTGTCTGTCGTCCCAGA No data
Right 985350739 4:189058680-189058702 CTCCCTTGACTTCTCCCCTCCGG No data
985350734_985350743 12 Left 985350734 4:189058655-189058677 CCGCTGTTGTCTGTCGTCCCAGA No data
Right 985350743 4:189058690-189058712 TTCTCCCCTCCGGATCTGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985350734 Original CRISPR TCTGGGACGACAGACAACAG CGG (reversed) Intergenic
No off target data available for this crispr