ID: 985350736

View in Genome Browser
Species Human (GRCh38)
Location 4:189058673-189058695
Sequence GGAGAAGTCAAGGGAGGGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985350736_985350742 -10 Left 985350736 4:189058673-189058695 CCAGACCCTCCCTTGACTTCTCC No data
Right 985350742 4:189058686-189058708 TGACTTCTCCCCTCCGGATCTGG No data
985350736_985350743 -6 Left 985350736 4:189058673-189058695 CCAGACCCTCCCTTGACTTCTCC No data
Right 985350743 4:189058690-189058712 TTCTCCCCTCCGGATCTGGCAGG No data
985350736_985350744 -5 Left 985350736 4:189058673-189058695 CCAGACCCTCCCTTGACTTCTCC No data
Right 985350744 4:189058691-189058713 TCTCCCCTCCGGATCTGGCAGGG No data
985350736_985350750 23 Left 985350736 4:189058673-189058695 CCAGACCCTCCCTTGACTTCTCC No data
Right 985350750 4:189058719-189058741 ACTGCGTTTCTGATCCAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985350736 Original CRISPR GGAGAAGTCAAGGGAGGGTC TGG (reversed) Intergenic
No off target data available for this crispr