ID: 985350737

View in Genome Browser
Species Human (GRCh38)
Location 4:189058678-189058700
Sequence GGAGGGGAGAAGTCAAGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985350737_985350744 -10 Left 985350737 4:189058678-189058700 CCCTCCCTTGACTTCTCCCCTCC No data
Right 985350744 4:189058691-189058713 TCTCCCCTCCGGATCTGGCAGGG No data
985350737_985350750 18 Left 985350737 4:189058678-189058700 CCCTCCCTTGACTTCTCCCCTCC No data
Right 985350750 4:189058719-189058741 ACTGCGTTTCTGATCCAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985350737 Original CRISPR GGAGGGGAGAAGTCAAGGGA GGG (reversed) Intergenic
No off target data available for this crispr