ID: 985350739

View in Genome Browser
Species Human (GRCh38)
Location 4:189058680-189058702
Sequence CTCCCTTGACTTCTCCCCTC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985350732_985350739 8 Left 985350732 4:189058649-189058671 CCACCACCGCTGTTGTCTGTCGT No data
Right 985350739 4:189058680-189058702 CTCCCTTGACTTCTCCCCTCCGG No data
985350731_985350739 12 Left 985350731 4:189058645-189058667 CCGTCCACCACCGCTGTTGTCTG No data
Right 985350739 4:189058680-189058702 CTCCCTTGACTTCTCCCCTCCGG No data
985350733_985350739 5 Left 985350733 4:189058652-189058674 CCACCGCTGTTGTCTGTCGTCCC No data
Right 985350739 4:189058680-189058702 CTCCCTTGACTTCTCCCCTCCGG No data
985350734_985350739 2 Left 985350734 4:189058655-189058677 CCGCTGTTGTCTGTCGTCCCAGA No data
Right 985350739 4:189058680-189058702 CTCCCTTGACTTCTCCCCTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985350739 Original CRISPR CTCCCTTGACTTCTCCCCTC CGG Intergenic
No off target data available for this crispr