ID: 985350743

View in Genome Browser
Species Human (GRCh38)
Location 4:189058690-189058712
Sequence TTCTCCCCTCCGGATCTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985350735_985350743 -5 Left 985350735 4:189058672-189058694 CCCAGACCCTCCCTTGACTTCTC No data
Right 985350743 4:189058690-189058712 TTCTCCCCTCCGGATCTGGCAGG No data
985350731_985350743 22 Left 985350731 4:189058645-189058667 CCGTCCACCACCGCTGTTGTCTG No data
Right 985350743 4:189058690-189058712 TTCTCCCCTCCGGATCTGGCAGG No data
985350736_985350743 -6 Left 985350736 4:189058673-189058695 CCAGACCCTCCCTTGACTTCTCC No data
Right 985350743 4:189058690-189058712 TTCTCCCCTCCGGATCTGGCAGG No data
985350732_985350743 18 Left 985350732 4:189058649-189058671 CCACCACCGCTGTTGTCTGTCGT No data
Right 985350743 4:189058690-189058712 TTCTCCCCTCCGGATCTGGCAGG No data
985350734_985350743 12 Left 985350734 4:189058655-189058677 CCGCTGTTGTCTGTCGTCCCAGA No data
Right 985350743 4:189058690-189058712 TTCTCCCCTCCGGATCTGGCAGG No data
985350733_985350743 15 Left 985350733 4:189058652-189058674 CCACCGCTGTTGTCTGTCGTCCC No data
Right 985350743 4:189058690-189058712 TTCTCCCCTCCGGATCTGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985350743 Original CRISPR TTCTCCCCTCCGGATCTGGC AGG Intergenic
No off target data available for this crispr