ID: 985350744

View in Genome Browser
Species Human (GRCh38)
Location 4:189058691-189058713
Sequence TCTCCCCTCCGGATCTGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985350736_985350744 -5 Left 985350736 4:189058673-189058695 CCAGACCCTCCCTTGACTTCTCC No data
Right 985350744 4:189058691-189058713 TCTCCCCTCCGGATCTGGCAGGG No data
985350737_985350744 -10 Left 985350737 4:189058678-189058700 CCCTCCCTTGACTTCTCCCCTCC No data
Right 985350744 4:189058691-189058713 TCTCCCCTCCGGATCTGGCAGGG No data
985350733_985350744 16 Left 985350733 4:189058652-189058674 CCACCGCTGTTGTCTGTCGTCCC No data
Right 985350744 4:189058691-189058713 TCTCCCCTCCGGATCTGGCAGGG No data
985350732_985350744 19 Left 985350732 4:189058649-189058671 CCACCACCGCTGTTGTCTGTCGT No data
Right 985350744 4:189058691-189058713 TCTCCCCTCCGGATCTGGCAGGG No data
985350731_985350744 23 Left 985350731 4:189058645-189058667 CCGTCCACCACCGCTGTTGTCTG No data
Right 985350744 4:189058691-189058713 TCTCCCCTCCGGATCTGGCAGGG No data
985350735_985350744 -4 Left 985350735 4:189058672-189058694 CCCAGACCCTCCCTTGACTTCTC No data
Right 985350744 4:189058691-189058713 TCTCCCCTCCGGATCTGGCAGGG No data
985350734_985350744 13 Left 985350734 4:189058655-189058677 CCGCTGTTGTCTGTCGTCCCAGA No data
Right 985350744 4:189058691-189058713 TCTCCCCTCCGGATCTGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985350744 Original CRISPR TCTCCCCTCCGGATCTGGCA GGG Intergenic
No off target data available for this crispr