ID: 985351132

View in Genome Browser
Species Human (GRCh38)
Location 4:189062326-189062348
Sequence CTGCCCATTCTGAATTAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985351132_985351137 21 Left 985351132 4:189062326-189062348 CCTCCTTAATTCAGAATGGGCAG No data
Right 985351137 4:189062370-189062392 TCAAGGCAAACATGGGCCTATGG No data
985351132_985351136 14 Left 985351132 4:189062326-189062348 CCTCCTTAATTCAGAATGGGCAG No data
Right 985351136 4:189062363-189062385 ACTAGAGTCAAGGCAAACATGGG No data
985351132_985351134 4 Left 985351132 4:189062326-189062348 CCTCCTTAATTCAGAATGGGCAG No data
Right 985351134 4:189062353-189062375 CTAATCACTTACTAGAGTCAAGG No data
985351132_985351135 13 Left 985351132 4:189062326-189062348 CCTCCTTAATTCAGAATGGGCAG No data
Right 985351135 4:189062362-189062384 TACTAGAGTCAAGGCAAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985351132 Original CRISPR CTGCCCATTCTGAATTAAGG AGG (reversed) Intergenic
No off target data available for this crispr