ID: 985355789

View in Genome Browser
Species Human (GRCh38)
Location 4:189117191-189117213
Sequence CAGCATCAGCTGAAGTAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985355789_985355793 6 Left 985355789 4:189117191-189117213 CCCTCCTACTTCAGCTGATGCTG No data
Right 985355793 4:189117220-189117242 AAGTGCCCGCTCCTAGTCTGAGG No data
985355789_985355795 11 Left 985355789 4:189117191-189117213 CCCTCCTACTTCAGCTGATGCTG No data
Right 985355795 4:189117225-189117247 CCCGCTCCTAGTCTGAGGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985355789 Original CRISPR CAGCATCAGCTGAAGTAGGA GGG (reversed) Intergenic
No off target data available for this crispr