ID: 985357224

View in Genome Browser
Species Human (GRCh38)
Location 4:189134324-189134346
Sequence GTTAGCAAGCTGACCTATTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985357224_985357226 15 Left 985357224 4:189134324-189134346 CCTAAATAGGTCAGCTTGCTAAC No data
Right 985357226 4:189134362-189134384 TTTTACTGTGAAATATTTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985357224 Original CRISPR GTTAGCAAGCTGACCTATTT AGG (reversed) Intergenic
No off target data available for this crispr