ID: 985359107

View in Genome Browser
Species Human (GRCh38)
Location 4:189153587-189153609
Sequence TATTTACTAAAGCAGGTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985359107_985359113 18 Left 985359107 4:189153587-189153609 CCCACCACCTGCTTTAGTAAATA No data
Right 985359113 4:189153628-189153650 CACACCACTCATTTCGTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985359107 Original CRISPR TATTTACTAAAGCAGGTGGT GGG (reversed) Intergenic
No off target data available for this crispr