ID: 985365775

View in Genome Browser
Species Human (GRCh38)
Location 4:189231075-189231097
Sequence CAATTGTAGCAGAAGGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985365771_985365775 -9 Left 985365771 4:189231061-189231083 CCTCAGGGCACTTACAATTGTAG No data
Right 985365775 4:189231075-189231097 CAATTGTAGCAGAAGGTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985365775 Original CRISPR CAATTGTAGCAGAAGGTGGA GGG Intergenic
No off target data available for this crispr