ID: 985378567

View in Genome Browser
Species Human (GRCh38)
Location 4:189368283-189368305
Sequence ATGTTACAGGCTAACCCAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985378567_985378573 15 Left 985378567 4:189368283-189368305 CCACTTGGGTTAGCCTGTAACAT No data
Right 985378573 4:189368321-189368343 AAAGAAAGAAAATGAGGGCAGGG No data
985378567_985378571 10 Left 985378567 4:189368283-189368305 CCACTTGGGTTAGCCTGTAACAT No data
Right 985378571 4:189368316-189368338 AAAAAAAAGAAAGAAAATGAGGG 0: 6
1: 101
2: 1080
3: 10702
4: 62182
985378567_985378570 9 Left 985378567 4:189368283-189368305 CCACTTGGGTTAGCCTGTAACAT No data
Right 985378570 4:189368315-189368337 AAAAAAAAAGAAAGAAAATGAGG 0: 35
1: 295
2: 1821
3: 15765
4: 67232
985378567_985378572 14 Left 985378567 4:189368283-189368305 CCACTTGGGTTAGCCTGTAACAT No data
Right 985378572 4:189368320-189368342 AAAAGAAAGAAAATGAGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985378567 Original CRISPR ATGTTACAGGCTAACCCAAG TGG (reversed) Intergenic
No off target data available for this crispr