ID: 985378570

View in Genome Browser
Species Human (GRCh38)
Location 4:189368315-189368337
Sequence AAAAAAAAAGAAAGAAAATG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 85148
Summary {0: 35, 1: 295, 2: 1821, 3: 15765, 4: 67232}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985378569_985378570 -4 Left 985378569 4:189368296-189368318 CCTGTAACATTGGAAAAAAAAAA No data
Right 985378570 4:189368315-189368337 AAAAAAAAAGAAAGAAAATGAGG 0: 35
1: 295
2: 1821
3: 15765
4: 67232
985378567_985378570 9 Left 985378567 4:189368283-189368305 CCACTTGGGTTAGCCTGTAACAT No data
Right 985378570 4:189368315-189368337 AAAAAAAAAGAAAGAAAATGAGG 0: 35
1: 295
2: 1821
3: 15765
4: 67232

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985378570 Original CRISPR AAAAAAAAAGAAAGAAAATG AGG Intergenic
Too many off-targets to display for this crispr