ID: 985378571 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 4:189368316-189368338 |
Sequence | AAAAAAAAGAAAGAAAATGA GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 74071 | |||
Summary | {0: 6, 1: 101, 2: 1080, 3: 10702, 4: 62182} |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
985378569_985378571 | -3 | Left | 985378569 | 4:189368296-189368318 | CCTGTAACATTGGAAAAAAAAAA | No data | ||
Right | 985378571 | 4:189368316-189368338 | AAAAAAAAGAAAGAAAATGAGGG | 0: 6 1: 101 2: 1080 3: 10702 4: 62182 |
||||
985378567_985378571 | 10 | Left | 985378567 | 4:189368283-189368305 | CCACTTGGGTTAGCCTGTAACAT | No data | ||
Right | 985378571 | 4:189368316-189368338 | AAAAAAAAGAAAGAAAATGAGGG | 0: 6 1: 101 2: 1080 3: 10702 4: 62182 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
985378571 | Original CRISPR | AAAAAAAAGAAAGAAAATGA GGG | Intergenic | ||
Too many off-targets to display for this crispr |