ID: 985378571

View in Genome Browser
Species Human (GRCh38)
Location 4:189368316-189368338
Sequence AAAAAAAAGAAAGAAAATGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 74071
Summary {0: 6, 1: 101, 2: 1080, 3: 10702, 4: 62182}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985378569_985378571 -3 Left 985378569 4:189368296-189368318 CCTGTAACATTGGAAAAAAAAAA No data
Right 985378571 4:189368316-189368338 AAAAAAAAGAAAGAAAATGAGGG 0: 6
1: 101
2: 1080
3: 10702
4: 62182
985378567_985378571 10 Left 985378567 4:189368283-189368305 CCACTTGGGTTAGCCTGTAACAT No data
Right 985378571 4:189368316-189368338 AAAAAAAAGAAAGAAAATGAGGG 0: 6
1: 101
2: 1080
3: 10702
4: 62182

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985378571 Original CRISPR AAAAAAAAGAAAGAAAATGA GGG Intergenic
Too many off-targets to display for this crispr