ID: 985378573

View in Genome Browser
Species Human (GRCh38)
Location 4:189368321-189368343
Sequence AAAGAAAGAAAATGAGGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985378567_985378573 15 Left 985378567 4:189368283-189368305 CCACTTGGGTTAGCCTGTAACAT No data
Right 985378573 4:189368321-189368343 AAAGAAAGAAAATGAGGGCAGGG No data
985378569_985378573 2 Left 985378569 4:189368296-189368318 CCTGTAACATTGGAAAAAAAAAA No data
Right 985378573 4:189368321-189368343 AAAGAAAGAAAATGAGGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985378573 Original CRISPR AAAGAAAGAAAATGAGGGCA GGG Intergenic
No off target data available for this crispr