ID: 985378575

View in Genome Browser
Species Human (GRCh38)
Location 4:189368341-189368363
Sequence GGGAAATTCGCCACGAGCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985378569_985378575 22 Left 985378569 4:189368296-189368318 CCTGTAACATTGGAAAAAAAAAA No data
Right 985378575 4:189368341-189368363 GGGAAATTCGCCACGAGCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985378575 Original CRISPR GGGAAATTCGCCACGAGCAA GGG Intergenic
No off target data available for this crispr