ID: 985381179

View in Genome Browser
Species Human (GRCh38)
Location 4:189396579-189396601
Sequence ACGTGCTGCTGCGCTGGTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985381168_985381179 13 Left 985381168 4:189396543-189396565 CCCAGTAGCCCAGCATGAAGGGC No data
Right 985381179 4:189396579-189396601 ACGTGCTGCTGCGCTGGTGCAGG No data
985381175_985381179 4 Left 985381175 4:189396552-189396574 CCAGCATGAAGGGCTGGGAGGGG No data
Right 985381179 4:189396579-189396601 ACGTGCTGCTGCGCTGGTGCAGG No data
985381169_985381179 12 Left 985381169 4:189396544-189396566 CCAGTAGCCCAGCATGAAGGGCT No data
Right 985381179 4:189396579-189396601 ACGTGCTGCTGCGCTGGTGCAGG No data
985381165_985381179 24 Left 985381165 4:189396532-189396554 CCAAAAGCATACCCAGTAGCCCA No data
Right 985381179 4:189396579-189396601 ACGTGCTGCTGCGCTGGTGCAGG No data
985381173_985381179 5 Left 985381173 4:189396551-189396573 CCCAGCATGAAGGGCTGGGAGGG No data
Right 985381179 4:189396579-189396601 ACGTGCTGCTGCGCTGGTGCAGG No data
985381164_985381179 25 Left 985381164 4:189396531-189396553 CCCAAAAGCATACCCAGTAGCCC No data
Right 985381179 4:189396579-189396601 ACGTGCTGCTGCGCTGGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985381179 Original CRISPR ACGTGCTGCTGCGCTGGTGC AGG Intergenic
No off target data available for this crispr