ID: 985384306

View in Genome Browser
Species Human (GRCh38)
Location 4:189429306-189429328
Sequence TGTCCGCTTGGCCGAGTCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985384306_985384310 -3 Left 985384306 4:189429306-189429328 CCAGGGACTCGGCCAAGCGGACA No data
Right 985384310 4:189429326-189429348 ACACAGGGTTCTCACTGCAGAGG No data
985384306_985384312 17 Left 985384306 4:189429306-189429328 CCAGGGACTCGGCCAAGCGGACA No data
Right 985384312 4:189429346-189429368 AGGTGGAGTCTGAGTGCACCAGG No data
985384306_985384313 22 Left 985384306 4:189429306-189429328 CCAGGGACTCGGCCAAGCGGACA No data
Right 985384313 4:189429351-189429373 GAGTCTGAGTGCACCAGGCAAGG No data
985384306_985384314 29 Left 985384306 4:189429306-189429328 CCAGGGACTCGGCCAAGCGGACA No data
Right 985384314 4:189429358-189429380 AGTGCACCAGGCAAGGAATGAGG No data
985384306_985384311 0 Left 985384306 4:189429306-189429328 CCAGGGACTCGGCCAAGCGGACA No data
Right 985384311 4:189429329-189429351 CAGGGTTCTCACTGCAGAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985384306 Original CRISPR TGTCCGCTTGGCCGAGTCCC TGG (reversed) Intergenic
No off target data available for this crispr