ID: 985393899

View in Genome Browser
Species Human (GRCh38)
Location 4:189520967-189520989
Sequence TCATTTCCATAAAGAGAACT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985393899_985393900 5 Left 985393899 4:189520967-189520989 CCTAGTTCTCTTTATGGAAATGA No data
Right 985393900 4:189520995-189521017 GAGAGCAAAGCCCAGCCTCTTGG No data
985393899_985393901 8 Left 985393899 4:189520967-189520989 CCTAGTTCTCTTTATGGAAATGA No data
Right 985393901 4:189520998-189521020 AGCAAAGCCCAGCCTCTTGGTGG No data
985393899_985393904 16 Left 985393899 4:189520967-189520989 CCTAGTTCTCTTTATGGAAATGA No data
Right 985393904 4:189521006-189521028 CCAGCCTCTTGGTGGTAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985393899 Original CRISPR TCATTTCCATAAAGAGAACT AGG (reversed) Intergenic
No off target data available for this crispr