ID: 985395443

View in Genome Browser
Species Human (GRCh38)
Location 4:189538718-189538740
Sequence GACGGTCCTGTCTCATGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985395443_985395454 23 Left 985395443 4:189538718-189538740 CCTGCCCATGAGACAGGACCGTC No data
Right 985395454 4:189538764-189538786 CCATCTTCTCCTAGGGCCCCAGG No data
985395443_985395452 16 Left 985395443 4:189538718-189538740 CCTGCCCATGAGACAGGACCGTC No data
Right 985395452 4:189538757-189538779 CTGTTTGCCATCTTCTCCTAGGG No data
985395443_985395455 27 Left 985395443 4:189538718-189538740 CCTGCCCATGAGACAGGACCGTC No data
Right 985395455 4:189538768-189538790 CTTCTCCTAGGGCCCCAGGCTGG No data
985395443_985395456 30 Left 985395443 4:189538718-189538740 CCTGCCCATGAGACAGGACCGTC No data
Right 985395456 4:189538771-189538793 CTCCTAGGGCCCCAGGCTGGCGG No data
985395443_985395451 15 Left 985395443 4:189538718-189538740 CCTGCCCATGAGACAGGACCGTC No data
Right 985395451 4:189538756-189538778 CCTGTTTGCCATCTTCTCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985395443 Original CRISPR GACGGTCCTGTCTCATGGGC AGG (reversed) Intergenic
No off target data available for this crispr