ID: 985397801

View in Genome Browser
Species Human (GRCh38)
Location 4:189563307-189563329
Sequence CTGTGTCCGTATCAAGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985397801_985397805 -6 Left 985397801 4:189563307-189563329 CCCTCCACTTGATACGGACACAG No data
Right 985397805 4:189563324-189563346 ACACAGGTTTATCCATTAACAGG No data
985397801_985397810 29 Left 985397801 4:189563307-189563329 CCCTCCACTTGATACGGACACAG No data
Right 985397810 4:189563359-189563381 ACCAGAAGTACGTCTGATTTGGG No data
985397801_985397806 1 Left 985397801 4:189563307-189563329 CCCTCCACTTGATACGGACACAG No data
Right 985397806 4:189563331-189563353 TTTATCCATTAACAGGATTCCGG No data
985397801_985397809 28 Left 985397801 4:189563307-189563329 CCCTCCACTTGATACGGACACAG No data
Right 985397809 4:189563358-189563380 AACCAGAAGTACGTCTGATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985397801 Original CRISPR CTGTGTCCGTATCAAGTGGA GGG (reversed) Intergenic
No off target data available for this crispr