ID: 985399375

View in Genome Browser
Species Human (GRCh38)
Location 4:189579376-189579398
Sequence CAAGCTAGGGAGTTGGAACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985399375_985399381 -3 Left 985399375 4:189579376-189579398 CCCAGTTCCAACTCCCTAGCTTG No data
Right 985399381 4:189579396-189579418 TTGATGGCCTTTATACAACGTGG No data
985399375_985399383 24 Left 985399375 4:189579376-189579398 CCCAGTTCCAACTCCCTAGCTTG No data
Right 985399383 4:189579423-189579445 TAAACTTTAGTTCCTTCATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985399375 Original CRISPR CAAGCTAGGGAGTTGGAACT GGG (reversed) Intergenic
No off target data available for this crispr