ID: 985403787

View in Genome Browser
Species Human (GRCh38)
Location 4:189616569-189616591
Sequence TCCACTGGGTGAAGCCAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2395
Summary {0: 849, 1: 786, 2: 340, 3: 179, 4: 241}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985403787_985403798 24 Left 985403787 4:189616569-189616591 CCCAGCTGGCTTCACCCAGTGGA 0: 849
1: 786
2: 340
3: 179
4: 241
Right 985403798 4:189616616-189616638 GCTGCCTGCCAGTCCCGCGCCGG No data
985403787_985403794 -3 Left 985403787 4:189616569-189616591 CCCAGCTGGCTTCACCCAGTGGA 0: 849
1: 786
2: 340
3: 179
4: 241
Right 985403794 4:189616589-189616611 GGATCCCGCACAGGGGCTGCAGG 0: 38
1: 317
2: 516
3: 423
4: 563
985403787_985403795 0 Left 985403787 4:189616569-189616591 CCCAGCTGGCTTCACCCAGTGGA 0: 849
1: 786
2: 340
3: 179
4: 241
Right 985403795 4:189616592-189616614 TCCCGCACAGGGGCTGCAGGTGG 0: 35
1: 325
2: 499
3: 420
4: 525
985403787_985403799 25 Left 985403787 4:189616569-189616591 CCCAGCTGGCTTCACCCAGTGGA 0: 849
1: 786
2: 340
3: 179
4: 241
Right 985403799 4:189616617-189616639 CTGCCTGCCAGTCCCGCGCCGGG No data
985403787_985403791 -10 Left 985403787 4:189616569-189616591 CCCAGCTGGCTTCACCCAGTGGA 0: 849
1: 786
2: 340
3: 179
4: 241
Right 985403791 4:189616582-189616604 ACCCAGTGGATCCCGCACAGGGG 0: 33
1: 306
2: 541
3: 529
4: 339

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985403787 Original CRISPR TCCACTGGGTGAAGCCAGCT GGG (reversed) Intergenic
Too many off-targets to display for this crispr