ID: 985403788

View in Genome Browser
Species Human (GRCh38)
Location 4:189616570-189616592
Sequence ATCCACTGGGTGAAGCCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2428
Summary {0: 862, 1: 802, 2: 346, 3: 181, 4: 237}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985403788_985403799 24 Left 985403788 4:189616570-189616592 CCAGCTGGCTTCACCCAGTGGAT 0: 862
1: 802
2: 346
3: 181
4: 237
Right 985403799 4:189616617-189616639 CTGCCTGCCAGTCCCGCGCCGGG No data
985403788_985403798 23 Left 985403788 4:189616570-189616592 CCAGCTGGCTTCACCCAGTGGAT 0: 862
1: 802
2: 346
3: 181
4: 237
Right 985403798 4:189616616-189616638 GCTGCCTGCCAGTCCCGCGCCGG No data
985403788_985403795 -1 Left 985403788 4:189616570-189616592 CCAGCTGGCTTCACCCAGTGGAT 0: 862
1: 802
2: 346
3: 181
4: 237
Right 985403795 4:189616592-189616614 TCCCGCACAGGGGCTGCAGGTGG 0: 35
1: 325
2: 499
3: 420
4: 525
985403788_985403794 -4 Left 985403788 4:189616570-189616592 CCAGCTGGCTTCACCCAGTGGAT 0: 862
1: 802
2: 346
3: 181
4: 237
Right 985403794 4:189616589-189616611 GGATCCCGCACAGGGGCTGCAGG 0: 38
1: 317
2: 516
3: 423
4: 563

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985403788 Original CRISPR ATCCACTGGGTGAAGCCAGC TGG (reversed) Intergenic
Too many off-targets to display for this crispr