ID: 985403792

View in Genome Browser
Species Human (GRCh38)
Location 4:189616583-189616605
Sequence GCCCCTGTGCGGGATCCACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1988
Summary {0: 41, 1: 423, 2: 623, 3: 531, 4: 370}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985403792_985403798 10 Left 985403792 4:189616583-189616605 CCCAGTGGATCCCGCACAGGGGC 0: 41
1: 423
2: 623
3: 531
4: 370
Right 985403798 4:189616616-189616638 GCTGCCTGCCAGTCCCGCGCCGG No data
985403792_985403799 11 Left 985403792 4:189616583-189616605 CCCAGTGGATCCCGCACAGGGGC 0: 41
1: 423
2: 623
3: 531
4: 370
Right 985403799 4:189616617-189616639 CTGCCTGCCAGTCCCGCGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985403792 Original CRISPR GCCCCTGTGCGGGATCCACT GGG (reversed) Intergenic
900092791 1:927690-927712 GCCCCTGTGCAGGGTCCCCAAGG - Intronic
900113196 1:1018250-1018272 GCCCCAGTGCGGGATCCACTGGG - Intergenic
900463763 1:2813688-2813710 GGCCCAGAGGGGGATCCACTAGG + Intergenic
901005348 1:6169190-6169212 GCACAGGTGCGGGATCCACGAGG - Intronic
901045908 1:6395712-6395734 GCCCCAGTGCGGGACCCACTGGG - Intergenic
901783419 1:11609138-11609160 GCCCCGGTGTGGGACCCACTGGG + Intergenic
902032542 1:13433785-13433807 GCCCCGGTGTGGGATCCACTGGG - Intergenic
902033521 1:13439669-13439691 GCCCCGGTAGGGGATCCACTGGG + Intergenic
902100352 1:13983101-13983123 GCCCCCGTGCGAGATCCACTGGG - Intergenic
902637370 1:17743426-17743448 GCAGCTGTCCGGGACCCACTGGG - Intergenic
903624679 1:24721904-24721926 GCCCTGGTACAGGATCCACTGGG + Intergenic
904238815 1:29131082-29131104 GCCCCGGTGTGGGATCCACTGGG - Intergenic
904438525 1:30514967-30514989 GGCCCAGTGTGGGAACCACTGGG - Intergenic
905375706 1:37518674-37518696 GCCCCGGTGCGGGATCCACTAGG + Intergenic
906083060 1:43107301-43107323 GCCCTGGTGCGAGATCCACTGGG - Intergenic
906563430 1:46778447-46778469 ACCCCGGTGCAGAATCCACTGGG - Intronic
906876216 1:49541741-49541763 GCCCCTGTGCAGGATCCACTAGG + Intronic
906877636 1:49556646-49556668 GCCCCTGCGCGGGATCCACTAGG - Intronic
907092215 1:51735657-51735679 GGCCCTGTGCCGGATCCTTTGGG - Intronic
907102158 1:51847316-51847338 GGCCCGGTGCTGGATCCACTGGG - Intronic
907371081 1:54004163-54004185 GGCCCGGTGCGGGATCCACTTGG - Intergenic
907759432 1:57343388-57343410 GCCCTGGTGCAGGATCCACTGGG - Intronic
907980129 1:59472507-59472529 GCCCCGGTGCGGGATCCACTGGG + Intronic
908301193 1:62761952-62761974 GCCCTGGCGCAGGATCCACTAGG + Intergenic
908888663 1:68818130-68818152 GCCCCAGTGCGAGATCCACTGGG + Intergenic
909317951 1:74247838-74247860 GCCCCTGCGTGGGATCTACTAGG - Intronic
909318468 1:74253275-74253297 GCCCCTGTGCGGGATCCACTGGG - Intronic
909377001 1:74951986-74952008 GCCCTGGTGCAGGATCCACTAGG - Intergenic
909608659 1:77531702-77531724 GGCCCAGTGCAGGATCCACTGGG - Intronic
909759314 1:79269542-79269564 GCCCCGGTGCAGGATCCACTGGG + Intergenic
909904490 1:81178545-81178567 GCCCCGGTGCCGGATCCACTAGG - Intergenic
910478753 1:87636167-87636189 GCCCTGGTGCGGGATCCACTAGG - Intergenic
910550374 1:88467491-88467513 GCCCCAGTGCCGGATCCACTAGG + Intergenic
910609678 1:89127979-89128001 GCCCCTGTGCGGGATCCACTAGG - Intronic
910693069 1:89984598-89984620 CCCCCACTGCAGGATCCACTGGG - Intergenic
911001522 1:93170651-93170673 GCCCAGGTGCGGGATCCACTGGG + Intronic
911205991 1:95091789-95091811 GCCTCGGTGCAGGATCTACTAGG + Intergenic
911259520 1:95669566-95669588 GCACCGGTGTGGGATCCACTGGG - Intergenic
911305157 1:96224276-96224298 GCCCCAGCGTGGGATCCACTAGG - Intergenic
911950958 1:104172750-104172772 ACCCTGGTGTGGGATCCACTAGG + Intergenic
911954424 1:104217382-104217404 GCCCCAGTGCGGGATCCACTAGG - Intergenic
912058049 1:105631173-105631195 GCCTTGGTGCGGGATCCACTAGG - Intergenic
912166236 1:107045190-107045212 GCCCAGGTGTGGGATCCACTGGG + Intergenic
912312800 1:108640807-108640829 GCCCCGGTGCGGGATCCACTAGG - Intronic
912316004 1:108667898-108667920 GCTCTGGTGCAGGATCCACTGGG + Intergenic
912538678 1:110396269-110396291 GCCCCAGTGCGAGATCCACTGGG - Intergenic
912819297 1:112854452-112854474 AGCCCCGTGCGGGATCCACTGGG - Intergenic
913160990 1:116146492-116146514 GCCCCAGTGCGGGATCCACTGGG - Intergenic
913469076 1:119171927-119171949 GCCCCGGTGCGGGATCCACTGGG + Intergenic
913470259 1:119179446-119179468 GCCCTGGTGCAGGATCCACTGGG + Intergenic
913486182 1:119334127-119334149 GCACCGGTACCGGATCCACTGGG + Intergenic
913987170 1:143575477-143575499 GCCCTGGTGCGAGATCCACTGGG + Intergenic
914438359 1:147680704-147680726 GCCCTGGTGCGGGATCCACTGGG - Intergenic
914508586 1:148310262-148310284 GCCCATGTGCGGGATTCGCCTGG + Intergenic
914928134 1:151906559-151906581 GCCCCAGTGCGAGATCCACTGGG + Intronic
915104199 1:153522199-153522221 GCCCTGGTGCAGGATCCACTGGG + Intergenic
915242252 1:154532027-154532049 GCCCCGGTGCGAGATCCACTGGG - Intronic
915260141 1:154671184-154671206 GCCCTGATGTGGGATCCACTGGG + Intergenic
915261311 1:154678471-154678493 GCCCTGATGTGGGATCCACTGGG + Intergenic
915666029 1:157446221-157446243 GCCCCCGTGGGAGATCCACTGGG - Intergenic
915764413 1:158348927-158348949 GCCCCAGTGCAGGATCCACTAGG - Intergenic
915767089 1:158374094-158374116 GCCCAGGTGCGGTATCCACTGGG - Intergenic
915865473 1:159494546-159494568 GCCCTGGTGCGGGATCCACTGGG - Intergenic
916115113 1:161479402-161479424 GCCCTGGTGCAGGATCCACTAGG + Intergenic
916605874 1:166342798-166342820 GCCCTGGTGCAGGATCCACTGGG - Intergenic
916910034 1:169337012-169337034 GCCCCGGTGCGGGATCCACTGGG - Intronic
916939102 1:169661595-169661617 GCCCTGGTGTGGGATCCACTGGG + Intergenic
916940140 1:169668433-169668455 GCCCCGGCGTGGGATCCACTGGG + Intronic
916960361 1:169882533-169882555 GCCCCAGTGCGGGATCCACTGGG + Intronic
916991539 1:170250659-170250681 GCCCCTGCGTGGGATCCACTAGG - Intergenic
917093910 1:171381604-171381626 GCCCCAGCATGGGATCCACTAGG - Intergenic
917348791 1:174056347-174056369 GCCCCAGTGCGGGATCCACTGGG - Intergenic
917445336 1:175102238-175102260 GCCCCAGTGCGGGATCCACTGGG - Intronic
917446292 1:175108395-175108417 GCCCCAGTGCGGGATCCACTCGG - Intronic
917578475 1:176349214-176349236 CCATCGGTGCGGGATCCACTGGG - Intergenic
917932909 1:179836835-179836857 GCCCCGGTGGGGGCTCTACTGGG - Intergenic
918059088 1:181046251-181046273 GCCCCAGTGGGGGATCCACTGGG + Intronic
918154650 1:181832833-181832855 GCCCTGGTGCAGGATCCACTAGG + Intergenic
918511942 1:185321654-185321676 GCCCCTGTGCAGGATCCACTGGG - Intergenic
918659688 1:187073754-187073776 GCCCCCGTGCGGGATCCACTTGG - Intergenic
918709020 1:187704042-187704064 GCCCCGGTGCGGGATCCACTGGG + Intergenic
918720910 1:187850624-187850646 GCCCCTGTGCGGGATCCACTGGG + Intergenic
918732228 1:188013259-188013281 GCCCAGGCACGGGATCCACTGGG - Intergenic
918790046 1:188813441-188813463 GCCCCAGTGCGGGATCCACTGGG + Intergenic
918791963 1:188841113-188841135 GCCTCAGTGCAGGATCCACTGGG - Intergenic
918853135 1:189718237-189718259 GCCCTCGTGCGGGATCCACTGGG - Intergenic
918942911 1:191025938-191025960 GCCCTGGTGCGGGATCCACTAGG - Intergenic
918952071 1:191151804-191151826 GCCCCGGTGCGGGATACACTGGG + Intergenic
919049709 1:192499015-192499037 GCCCCAGTGCAGGATCCACTGGG - Intergenic
919070696 1:192751512-192751534 GCCCTGGGGCGGGATGCACTAGG + Intergenic
919091983 1:192987331-192987353 GCCCTGGTGTGGGATCCACTGGG + Intergenic
919167878 1:193918850-193918872 GCGCTGGTGCGGGATCCACTAGG - Intergenic
919174546 1:194002261-194002283 GCCCTGGTGCGGGATCCACTAGG + Intergenic
919201275 1:194358207-194358229 GCCCTGGTGTGGCATCCACTGGG - Intergenic
919237094 1:194859422-194859444 GCACCGGTGCGGGATCCACTGGG + Intergenic
919250906 1:195054700-195054722 GCCCCAGTAAGGGATCCACTGGG + Intergenic
919297700 1:195722852-195722874 GCCCCCGTGCTGGATCCACTGGG - Intergenic
919631021 1:199960042-199960064 GCCCCAGTGCGGGAACCACTGGG + Intergenic
920150307 1:203900661-203900683 GCCCCAGTGGGGTAACCACTTGG + Intergenic
920731294 1:208488376-208488398 GCCCCAGTGTGGGATCCACTGGG - Intergenic
920756761 1:208740100-208740122 GCCCCGGTGCGGGATCCACTGGG + Intergenic
920878382 1:209858587-209858609 GCCCCGCTGCGGTATCCACTAGG - Intergenic
920881949 1:209888886-209888908 GCCCGGGTGCGGGATCCACTGGG - Intergenic
920883076 1:209898739-209898761 GCCCCGGTGCGGGATCCACTAGG - Intergenic
921094328 1:211874202-211874224 GCCCCTGTGCGGGATCCACTGGG - Intergenic
921396301 1:214673085-214673107 GCCCGGGTGCGGGATCCACTGGG - Intergenic
921801884 1:219411074-219411096 GCCCCGGTGCCGGATCCACTAGG + Intergenic
921897169 1:220412854-220412876 GCCCCGGTGCGGGATACACTAGG + Intergenic
921903756 1:220475606-220475628 GCCCCCGTGCTGGATCCACTGGG - Intergenic
921983597 1:221285596-221285618 GTCCTGGTGCGGGATCCACTGGG - Intergenic
922056902 1:222050168-222050190 GCCCCTGTGCGGGATCCATTGGG + Intergenic
922166059 1:223116900-223116922 GCCCTGACGCGGGATCCACTAGG - Intronic
922306902 1:224352457-224352479 GCCCCCGTGGTGAATCCACTGGG - Intergenic
922423288 1:225473129-225473151 GCCCCGGTGCGGGATCCACTAGG + Intergenic
922485502 1:225970188-225970210 GCACCAGTGCGGGATCCACTGGG + Intergenic
922541832 1:226426232-226426254 GCCCTGGTGCGTGATCCACTGGG - Intergenic
922855870 1:228774126-228774148 GCCCCGGTGCGGGATCCACTGGG + Intergenic
922985955 1:229865878-229865900 GCCCTGGTGCGGGATCCACTGGG + Intergenic
923157164 1:231289441-231289463 ATCCCTGTGCGGGATCCACTGGG - Intergenic
923172529 1:231430757-231430779 GCCCCAGTGCGGGATCCACTGGG - Intergenic
923193380 1:231641887-231641909 GCCCCGGTGCGGGATCCACTGGG - Intronic
923324736 1:232871382-232871404 GCCCCGGTGCGGGATCCACTGGG - Intergenic
923353261 1:233129542-233129564 GCCTCAGTGTGGGATCCACTGGG + Intronic
923573896 1:235140716-235140738 GCCCCGGTGCAGGATCCACTGGG + Intronic
923810445 1:237309568-237309590 GCCCTTGTGTGGGATCCAGTAGG - Intronic
923930002 1:238684570-238684592 GCCCCTGTGGGGGATCCACTGGG - Intergenic
924034716 1:239924705-239924727 CTCCCCGTGCAGGATCCACTAGG - Intergenic
924117601 1:240762910-240762932 GCCCCGGTGCGGGATCCACTGGG + Intergenic
924219161 1:241855519-241855541 AGCCCCGTGCGGGATCCACTGGG - Intronic
924306015 1:242689838-242689860 GCCCCGGGGCAGGATCCACTAGG + Intergenic
924313697 1:242774307-242774329 GCCCCAGCACGGGATCCACTAGG - Intergenic
1063148869 10:3319752-3319774 GCCCAGGTGTGGGATCCACTGGG - Intergenic
1063300312 10:4844853-4844875 GGCCCCGTGCGGGATCCACTGGG - Intronic
1063318646 10:5032457-5032479 GCCCCGGTGCGGGATCCACTGGG - Intronic
1063503838 10:6579351-6579373 GCCCCTGTGCGGGCTGGACGTGG - Intronic
1063769776 10:9183772-9183794 GCCCTGGTGCGGGATCCACTGGG + Intergenic
1064197864 10:13260028-13260050 GCCCCAGTGCCGGATCCACTAGG + Intergenic
1064449129 10:15426037-15426059 CCCTCGGTGAGGGATCCACTGGG - Intergenic
1064461105 10:15535359-15535381 GCGCCGGTGCGGGATCCACTAGG + Intronic
1065441415 10:25756420-25756442 GCCCCGGTACGGGATCCACTGGG + Intergenic
1065743202 10:28815612-28815634 GCCCCTGTGCGGGATCCACTGGG - Intergenic
1065752099 10:28896758-28896780 GCTCCGGTGCGGGATCCACTGGG - Intergenic
1065895961 10:30163234-30163256 GCCCCTGTGCGGGATCCACTGGG + Intergenic
1065981495 10:30902749-30902771 GGCCCGGTGGGAGATCCACTGGG - Intronic
1065983775 10:30930001-30930023 GCCCTGGCGAGGGATCCACTAGG - Intronic
1065995586 10:31056242-31056264 GCCCTGGTGCAGGATCCACTGGG + Intergenic
1066186377 10:33013714-33013736 GCCCCAGTGCGGGATCCACTAGG + Intergenic
1066190344 10:33049648-33049670 GCCCCGGTGCGGGATCCGCTAGG + Intergenic
1066234123 10:33468455-33468477 GCCCCGGTGTGGGATCCACTAGG + Intergenic
1066235378 10:33480406-33480428 GCCCCGGTGTGGGATCCACCGGG - Intergenic
1066293697 10:34035809-34035831 GCCCTGGTGCAGGATCCACTAGG + Intergenic
1066296173 10:34055937-34055959 GCCCCCGTGCGGGATCCACTGGG + Intergenic
1066544168 10:36481936-36481958 GGCCCGGTGCAGGATCCACTGGG - Intergenic
1066567323 10:36734557-36734579 GCCCCAGTGCGGGATCCACTAGG - Intergenic
1066598272 10:37076385-37076407 GCCCCAGTGCAGGATCCACTGGG + Intergenic
1066613537 10:37275264-37275286 GCCCTGGTGCAGGATTCACTAGG - Intronic
1066614990 10:37285106-37285128 GCCCTGGTGTGGGATCCACTAGG - Intronic
1066660955 10:37737751-37737773 GCCCCCGTGCGGGATCCACTGGG + Intergenic
1067146952 10:43701140-43701162 GCCCCTGGCCGGGACCCACTGGG - Intergenic
1067363272 10:45601163-45601185 GCCCTGGTGTGGGATCCACTGGG + Intergenic
1068211404 10:53924601-53924623 GCCCCAGTGCAGGATCCACTAGG + Intronic
1068374101 10:56155546-56155568 GCCCTGGTGCGGGATCCACTGGG + Intergenic
1068455607 10:57250262-57250284 GCCCCAGGGCGGCATCCACTGGG + Intergenic
1068460438 10:57321898-57321920 GCCCCTGGGCGGGATCCACTGGG + Intergenic
1068554884 10:58448194-58448216 GCCCCTGCGCAGGATCCACTAGG - Intergenic
1068792349 10:61041036-61041058 GCCCTGGTGCGGGATCCACTGGG + Intergenic
1068902193 10:62280800-62280822 GCCCTGGTGTGGGATCCACTAGG + Intergenic
1068978218 10:63034011-63034033 GCCCCGGTGCGGGATCCACCGGG + Intergenic
1069090732 10:64196711-64196733 GGCCCGGTGTGGGATCCACTAGG - Intergenic
1069186444 10:65429346-65429368 GCCCCTGTGCGGGATCCACCAGG - Intergenic
1069215277 10:65812031-65812053 GCCCTAGTGCCGGATTCACTGGG - Intergenic
1069766224 10:70862083-70862105 GCCCCGGTGCGGGATCCACTGGG + Intronic
1069988758 10:72301025-72301047 GCCCTGGTGCGGGATCCACTGGG + Intergenic
1070172801 10:73945025-73945047 GCACCCGTACAGGATCCACTAGG + Intergenic
1070564015 10:77590219-77590241 GCCCCGGTGCGGGATCCACTGGG - Intronic
1070937960 10:80315823-80315845 GCCCCAGTGCGGGATCCACTGGG + Intergenic
1070942491 10:80359435-80359457 GCCCTGATGCGGGATCCACTAGG - Intronic
1070968383 10:80543636-80543658 GCCCCAGTGCGGGATCCACTGGG + Intronic
1070973457 10:80586296-80586318 GCCCTGGTGCGCGATCCACTGGG + Intronic
1070999217 10:80814576-80814598 GCCCTGGTGCGGTATCCATTGGG + Intergenic
1071041010 10:81309013-81309035 GTCCCGGTGCGGGATCCACTGGG - Intergenic
1071055763 10:81506195-81506217 GCCCTGGTGCAGGATCCACTGGG + Intergenic
1071078788 10:81784640-81784662 GCCCCAGTGCAGGATCCACTAGG + Intergenic
1071085278 10:81862623-81862645 GCCCCAGTGCAGGATCCACTGGG - Intergenic
1071388079 10:85141822-85141844 GCCCTTGTGCGGGATCCACTGGG + Intergenic
1071797009 10:89018592-89018614 GCCCCGGTGCAGGATCCACGGGG - Intergenic
1071900931 10:90119768-90119790 GCCCCGGTGTGGGATCCACTGGG - Intergenic
1071963708 10:90832113-90832135 GCCCCAGTGCCAGATCCACTGGG - Intronic
1072724258 10:97801772-97801794 ACCCCGCTGCGGGGTCCACTGGG + Intergenic
1073249620 10:102113932-102113954 GCCCTTGTGCTGGAGCCACTGGG - Intronic
1073262419 10:102200832-102200854 GCCCCGGCGAGGGATCCACTAGG - Intergenic
1073532592 10:104245594-104245616 AGCCCTGTGCAGGATCCACTGGG + Intronic
1073789695 10:106928043-106928065 GCGCCGGTGCGGGATCCACTGGG - Intronic
1074098213 10:110331888-110331910 GCCCCAGTGCGGGATCCACTGGG + Intergenic
1074174982 10:110990185-110990207 GCCCTGGTGCGGGATCCACTAGG + Intronic
1074317235 10:112370747-112370769 GACCCAGTGCTGGATCCACTGGG + Intergenic
1074317362 10:112371638-112371660 GCCACGGTGCGGGATCGACTGGG + Intergenic
1074732539 10:116393774-116393796 GCCCCGGTGCAAGATCCACTGGG + Intergenic
1074996268 10:118760085-118760107 GCCCTCTTGCTGGATCCACTGGG - Intergenic
1074999307 10:118783325-118783347 GCCCCGGTGCGGGATGCACTAGG + Intergenic
1075255702 10:120924247-120924269 GCCCCTTTGCGGGATCCACTGGG + Intergenic
1075269306 10:121035277-121035299 GCCCCAGTGTGGGATCCACTAGG - Intergenic
1075305785 10:121365952-121365974 GCCCCAGTGCGGGATCCACTGGG + Intergenic
1075307695 10:121382541-121382563 GCCCCAGTGCGGGATCCACTGGG + Intergenic
1075375942 10:121978328-121978350 ACCCTGGTGCGGGATCCACTGGG - Intergenic
1075537442 10:123283292-123283314 GCCCCTTTGCGGGATCCACTGGG - Intergenic
1076261577 10:129071290-129071312 GCCCCGGTGCGGGATCCACTGGG - Intergenic
1077262234 11:1628924-1628946 GCCGCTGTCCGGGAGCCCCTGGG + Intergenic
1077378406 11:2216194-2216216 GCCTCCCTGCGGGATGCACTGGG + Intergenic
1077551360 11:3201828-3201850 GACCCTGTGAGGGCTCCTCTAGG + Intergenic
1077583723 11:3434923-3434945 GCCCTGGTGTGGGATCCACTGGG - Intergenic
1077764672 11:5144818-5144840 GCCCCGGTGTGGGATCCACTGGG + Intergenic
1077778139 11:5294381-5294403 GCCCAGGTGCGGGATCCACTGGG - Intronic
1077805842 11:5590301-5590323 GCCCCTGTGTGGGATCCACTAGG + Intronic
1078251825 11:9622973-9622995 GCCCCGGTGCGGGATCCACTAGG - Intergenic
1078301123 11:10133242-10133264 GCCCCTACGCGGGATCCACTAGG - Intronic
1078743615 11:14091265-14091287 GCCCCGGTGCGGGATCCACTAGG - Intronic
1078795900 11:14591487-14591509 GCCCCAGTGTGGGATTCACTGGG + Intronic
1078891420 11:15561345-15561367 GCCCCGGTGCGGTATCCACTGGG + Intergenic
1079190907 11:18276074-18276096 GCCCCGGTGCGGGATCCACTGGG - Intergenic
1079555347 11:21753080-21753102 GCCCCCGTGCGGGATCCATTGGG - Intergenic
1079708605 11:23653116-23653138 GCCCTGGTAAGGGATCCACTGGG - Intergenic
1079726145 11:23883369-23883391 GCCCTGGTGCGGGATCCACTAGG - Intergenic
1079731677 11:23942214-23942236 CCACCCGGGCGGGATCCACTGGG - Intergenic
1079767694 11:24415939-24415961 GCCCCAGTGTGGGATCCACTGGG - Intergenic
1079803267 11:24896720-24896742 GCCCCGGCACGGGATCCACTAGG + Intronic
1079867680 11:25756511-25756533 GCCCTGGTGCGGGATCCACTAGG + Intergenic
1080036651 11:27719034-27719056 GCCCCTGGGCGGGGGCCACCAGG - Intronic
1080105951 11:28512271-28512293 GCCCCGGTGCGGGATCCACTTGG - Intergenic
1080107424 11:28525735-28525757 GCCCCGGTGCGGGATCCACTGGG - Intergenic
1080195125 11:29600086-29600108 GCCCCGGTGTAGGATCCACTAGG - Intergenic
1080204501 11:29713076-29713098 GCCCCAGTGCAGGATCCACTGGG + Intergenic
1080503010 11:32888151-32888173 TGCCTGGTGCGGGATCCACTGGG - Intergenic
1080557616 11:33431681-33431703 GCCCCGGTGCGGGATCCACTGGG - Intergenic
1080621524 11:33990521-33990543 GCCCCGGTGCGGGATCCACTAGG + Intergenic
1081115273 11:39192570-39192592 GCCCCAGTGCAAGATCCACTGGG - Intergenic
1081125137 11:39312254-39312276 GCCCCGGTGCGGGATCCACTAGG + Intergenic
1081126859 11:39333007-39333029 GCCCCGGTGCAGGATCCACTGGG - Intergenic
1081315271 11:41623259-41623281 GCCCCAGTGCGGAATCCACTGGG + Intergenic
1081329633 11:41788164-41788186 GGCCCAGTGTGGGATCCACTGGG - Intergenic
1081374633 11:42344275-42344297 GCCCTGGCTCGGGATCCACTAGG - Intergenic
1081420976 11:42874335-42874357 GCCCTGGTGCAGGATCCACTGGG + Intergenic
1081422145 11:42881805-42881827 GCCCCAGTGCGGGATCCACTGGG + Intergenic
1081428463 11:42950308-42950330 GCCCTCGTGCGGGATCCACTGGG + Intergenic
1082106799 11:48229332-48229354 GACCTGGTGCGGGATCCACTAGG + Intergenic
1082270371 11:50163985-50164007 GCCCCAGTACGGGATCCACTGGG - Intergenic
1082272196 11:50183696-50183718 GCCCCAGGGCGGGATCCACTGGG + Intergenic
1082698682 11:56401858-56401880 GCCCCGGTGCAGGATCCACTGGG - Intergenic
1083074221 11:60020195-60020217 GCCCCGGTATGGGATCCACTGGG - Intergenic
1083546187 11:63550626-63550648 GCCCCGGTGCAGGATCCACTGGG + Intergenic
1084024672 11:66440716-66440738 GCCCGGGTGCGGGATCCGCTGGG - Intronic
1084107488 11:66989215-66989237 GCCCCGGTGCGGGATCCACTAGG + Intergenic
1084186719 11:67476475-67476497 GCCACGGTGCGCGATCCACTGGG + Intergenic
1084210543 11:67619459-67619481 GCACCGGTGCAGGATCCACTGGG + Intergenic
1084240627 11:67817595-67817617 GCCCCAGTGCAGGATCCACTTGG - Intergenic
1084259201 11:67963645-67963667 GCTCCTGTGCAGAATCCACTGGG + Intergenic
1084813571 11:71631534-71631556 GCTCCTGTGCGGGATCCACTGGG - Intergenic
1084831800 11:71775117-71775139 GCCCCAGTGCAGGATCCACTTGG + Intergenic
1085245681 11:75098630-75098652 GCCCCGGTGCGGGACCCACTGGG + Intergenic
1085375965 11:76060987-76061009 GCCCTGGTGCGGGATCTACTGGG + Intronic
1085447178 11:76608967-76608989 GCCCTGGTGCAGGATCCACTAGG - Intergenic
1085671016 11:78464908-78464930 GCCCCAGTGTGGGATCCACTGGG - Intronic
1085687771 11:78639277-78639299 AGCCCTGTGCAGGATCCACTAGG + Intergenic
1085941201 11:81208037-81208059 GCCCAGGTGCCAGATCCACTGGG + Intergenic
1085982717 11:81744454-81744476 GCCCTGGTGGGGGATCCACTAGG - Intergenic
1086001007 11:81986617-81986639 GCCCCGGCACCGGATCCACTAGG - Intergenic
1086034984 11:82404312-82404334 TCCCCGGTGCGGGATCCACTGGG + Intergenic
1086043108 11:82501580-82501602 GACCCGGTGCGGGATCCACTAGG + Intergenic
1086087647 11:82971099-82971121 GCCCCGGTGGCAGATCCACTGGG + Intergenic
1086210042 11:84308488-84308510 GCCCCCGTGCGGGATCCACTGGG - Intronic
1086397671 11:86433461-86433483 GCCCCGGTGCGGGATCCACTGGG - Intergenic
1086552584 11:88069469-88069491 GCCCTGGTGCGGGATCCACTAGG + Intergenic
1086808097 11:91269178-91269200 GCCCCGGTGCAGGATCCACTGGG + Intergenic
1087354614 11:97077022-97077044 GCCCTGGTGCGGGATCCACTAGG + Intergenic
1087407237 11:97745553-97745575 GCCCTGGTGGGAGATCCACTGGG - Intergenic
1087441110 11:98185153-98185175 GCCCCAGCGCAGGATCCACTAGG - Intergenic
1087486310 11:98763346-98763368 GCCCCGGTGCGGGATCCACTGGG - Intergenic
1087682270 11:101231273-101231295 GCCCTGGTGTGGGATCCACTAGG - Intergenic
1087683729 11:101241184-101241206 GCCCTGGTGCGGGATCCACTAGG - Intergenic
1087977184 11:104564890-104564912 GCCCTAGAACGGGATCCACTAGG - Intergenic
1088481636 11:110300875-110300897 CCCCTGGTGCGGGATCCCCTGGG - Intergenic
1088570952 11:111222399-111222421 GCCCTGGTGCGGGATCCACTAGG + Intergenic
1089062046 11:115633831-115633853 GCCCCAGTGCGAGATCCACTGGG - Intergenic
1089373493 11:117978425-117978447 GCCCCGGTGCGGGATCCATTAGG - Intergenic
1089466326 11:118688914-118688936 GCCGGGGTGCGGAATCCACTGGG - Intergenic
1089800322 11:121022082-121022104 GCCCCGGTGCGGGATCCACTGGG + Intergenic
1090229304 11:125089919-125089941 GCCCCGGTGCGGGATCCACTAGG + Intronic
1090307605 11:125704640-125704662 GCCCCGGTGCGGGATCCACTAGG - Intergenic
1090588321 11:128237466-128237488 AGCCCATTGCGGGATCCACTGGG + Intergenic
1090776646 11:129971770-129971792 GCCCCGGTGCGGGATCCACTGGG - Intronic
1090782790 11:130022027-130022049 GCCCCGGTGCGGGATCCACTGGG + Intergenic
1090820450 11:130337333-130337355 GCCCCTGTGGGGGATCCACTGGG - Intergenic
1090848081 11:130546907-130546929 GCCCCTCTGCGAGATCCACCGGG + Intergenic
1091201282 11:133782721-133782743 GCCCCGGTTTGGGATCCACTGGG + Intergenic
1091233371 11:134002826-134002848 GCCCCGGTGCGGGATCCACTGGG - Intergenic
1091402172 12:188055-188077 GCCCCAGTGAGGGATCCACTGGG - Intergenic
1092101626 12:5888833-5888855 GCCCCAGTGTGGGATCCACTGGG - Intronic
1092133999 12:6132903-6132925 GCCCCAGTGCGGGACCCACTGGG + Intergenic
1092135278 12:6142620-6142642 CCCCAGGTGCGGGATCCACTAGG + Intergenic
1092137506 12:6159897-6159919 GCCCAGGTGCGGGATCCACTGGG + Intergenic
1092142029 12:6190809-6190831 GCGCTGGTGCGGGATCCACTGGG - Intergenic
1092220363 12:6708704-6708726 GCCCCAGCGTGGGATCCTCTAGG + Intergenic
1092221477 12:6716458-6716480 GTCTCGGTGCGGGATCCACTAGG + Intergenic
1092272999 12:7037843-7037865 GCCCCGGTGCGGGATCTACTAGG + Intronic
1092336754 12:7640244-7640266 GCGCCGGTGCGGGATCCACTGGG + Intergenic
1092364128 12:7862608-7862630 GCACCGGTGCGTGATCCACTAGG + Intronic
1092410857 12:8252129-8252151 GCCCCCATGTGGGACCCACTTGG - Intergenic
1092430515 12:8404650-8404672 GCTCCTGTGCGGGATCCACTGGG + Intergenic
1092471849 12:8787688-8787710 GCCCCGGTGCGGGATTCACCGGG + Intergenic
1092473044 12:8795147-8795169 GCCCCGGTGCGGGATTCACCGGG + Intergenic
1092572344 12:9739508-9739530 GCCCCGGTGTGGGATCCACCGGG - Intergenic
1092583758 12:9876109-9876131 GCCCAGGTGCGGGATCCACTGGG - Intergenic
1092617070 12:10225551-10225573 GCCCCGGTGTGGGATCCACTGGG - Intergenic
1092732534 12:11547670-11547692 GCCCCGGTGGGGGATCCACTGGG + Intergenic
1092834146 12:12472372-12472394 GCTCTGGTGCAGGATCCACTGGG - Intergenic
1093034581 12:14320516-14320538 GCCCCATTGCGGGATCCACTGGG + Intergenic
1093172419 12:15875005-15875027 CGCCCGGTGCGAGATCCACTGGG + Intronic
1093189482 12:16057797-16057819 GCCCTGGTGCGGGATCCACTGGG + Intergenic
1093266353 12:17008046-17008068 GCCCCAGTGCGGGATCCACTGGG + Intergenic
1093346327 12:18040633-18040655 GCCCTGGTGCAGGATCCACCAGG + Intergenic
1093381639 12:18500567-18500589 GCCCCAATGCGAGATCCACTGGG + Intronic
1093443693 12:19230299-19230321 GGCCCAGTGCGGGATCCACTAGG - Intronic
1093524718 12:20093259-20093281 GCCCTGGTGCGAGATCCACTGGG - Intergenic
1093527015 12:20115168-20115190 GCCCCGGTGCGGGATCCACTAGG - Intergenic
1093580098 12:20777349-20777371 GCCCCGGTGCAAGATCCACTGGG - Intergenic
1093580957 12:20783718-20783740 ACCCCAGTGCAAGATCCACTGGG - Intergenic
1093653829 12:21673945-21673967 GCCCAGGTGCGGGATCCACTGGG - Intronic
1093741296 12:22692976-22692998 GCCCCAGCGCGGCATCCACTAGG - Intergenic
1093793799 12:23286350-23286372 GCCCCGGTGCGGGATCCACTGGG + Intergenic
1093970284 12:25369788-25369810 GCCCCTGTGCGGGATCCACTGGG + Intergenic
1093973033 12:25391851-25391873 GCCCTGGTGCAGGATTCACTGGG + Intergenic
1094327638 12:29257065-29257087 GACCGAGTGCGGGATCCACTGGG + Intronic
1094338523 12:29386179-29386201 GCCCAGGTGCGGGATCCATTGGG - Intergenic
1094405284 12:30110420-30110442 GCCCCAGTGCGGGATCCACTGGG - Intergenic
1094409915 12:30157282-30157304 GCCCTGGTGCGGGATCCACTGGG + Intergenic
1094448802 12:30562055-30562077 GCCCGGGTGCGGGATCCACTAGG + Intergenic
1094589224 12:31805727-31805749 GCCACGGTGCGGGATCCACTAGG - Intergenic
1094661361 12:32472714-32472736 GCCCCGGTGCGGGATCCACTAGG + Intronic
1094666562 12:32526094-32526116 GCCCCGGTGCGGGATCCACTAGG + Intronic
1094718118 12:33033869-33033891 GCCCCGGTGCGGGATCCACTGGG - Intergenic
1094828565 12:34289501-34289523 GCCCCTGTGTGGGGTCCGCAGGG - Intergenic
1094828800 12:34290487-34290509 GCGCCTGCGCGGGGTCCACGTGG - Intergenic
1094830558 12:34298264-34298286 GCCTCTGTGTGGCATCCACGGGG + Intergenic
1094833267 12:34310115-34310137 GCCCCTGTGCAGGATCCACTAGG + Intergenic
1095123168 12:38442371-38442393 GCCCTGGTGTGGGATCCACTGGG + Intergenic
1095304214 12:40621034-40621056 GCCCCGGTGAGGGATCCACTGGG + Intergenic
1095444884 12:42273646-42273668 GCCCTGGTGCAAGATCCACTGGG - Intronic
1095470761 12:42534420-42534442 GCCCCTGTGCTGGATGCCCAAGG - Intronic
1095478571 12:42610885-42610907 GCCCTGGTGCAGGATCCACTGGG - Intergenic
1095534038 12:43224702-43224724 GCCCCAGTGTGGCATCCACTGGG + Intergenic
1095587485 12:43864322-43864344 GCCCCAGTGCGAGATCCACTGGG + Intronic
1095642457 12:44500810-44500832 GCCCTGGTGCGGGATCTACTAGG + Intergenic
1095776778 12:46018439-46018461 GCCCCCGTGCGGGATCCACTAGG + Intergenic
1095901622 12:47333803-47333825 GTCCTGGTGAGGGATCCACTGGG + Intergenic
1097017843 12:56000083-56000105 GCACCAGTGCGGGATCCACTGGG - Intronic
1097128862 12:56795777-56795799 GCCCCGGTGCGGGATCCACTAGG - Intergenic
1097213004 12:57386691-57386713 GCCCCAGTGCAGGATCCACTGGG + Intronic
1097664123 12:62461213-62461235 GCCCTGGTGCGAGATCCACTGGG - Intergenic
1097863990 12:64543676-64543698 CCCCTAGTGCGCGATCCACTGGG + Intergenic
1097982080 12:65744736-65744758 GGCCCTGTGCGGGATCCACTGGG + Intergenic
1098168139 12:67719170-67719192 GCCCCTGTGCGGGATCCACTGGG - Intergenic
1098498678 12:71166138-71166160 GCTCCGGTGTGGGATCCACTGGG - Intronic
1098588753 12:72185468-72185490 GCCCCTGTGCGGGATCCACTAGG + Intronic
1098759319 12:74403370-74403392 GCCCCGGTGTGGGATCCACTAGG + Intergenic
1099190138 12:79553967-79553989 GCCCTGGTGCAGGATCCACTAGG - Intergenic
1099191040 12:79561970-79561992 GCCCTGGTGCGGGATCCACTAGG + Intergenic
1099191473 12:79565376-79565398 GCCCCGGTGTGGGATCCACTGGG + Intergenic
1099192504 12:79574294-79574316 GCCCCAGTGCGAGATCCATTGGG + Intergenic
1099204437 12:79711363-79711385 CTCCCGGTGCGGGACCCACTGGG + Intergenic
1099228079 12:79993160-79993182 ACCCCTGTGCAGGATCCACTGGG - Intergenic
1099413636 12:82361353-82361375 GCCCCAACGTGGGATCCACTAGG - Intronic
1099443897 12:82729145-82729167 GCCCCAGTGCGGGATCCACTGGG + Intronic
1099450512 12:82801975-82801997 GCCCCCGTGCAGGATCCACTGGG - Intronic
1099478737 12:83140484-83140506 GCCCTGGCGAGGGATCCACTAGG + Intergenic
1099523867 12:83696233-83696255 GCCCCAGTGAGGGATCCACCAGG - Intergenic
1099559547 12:84155061-84155083 GCCCTGGTGCAGGATCCACTAGG - Intergenic
1099716156 12:86296340-86296362 GCCCTGGTGTGGGATCCACTAGG - Intronic
1100142425 12:91634373-91634395 CCCCAGGTGCGGGATCCACTGGG + Intergenic
1100166543 12:91923846-91923868 ACCCCGGTGTGGGATCCACTGGG - Intergenic
1100211809 12:92406477-92406499 GCCCCGGTGCGGGATCCACTGGG - Intergenic
1100521531 12:95380007-95380029 GCCCCGGTGCGGGATCCACTAGG + Intronic
1100584770 12:95969556-95969578 GCCCCGGTGCGGGATCCACTAGG + Intergenic
1100734556 12:97512723-97512745 GCCCCGGTGCGGGATCCACTGGG - Intergenic
1101009071 12:100430724-100430746 GCCCCGGTGCGGGATCCACTGGG + Intergenic
1101021699 12:100559804-100559826 GCCCTGGTGCCGGATCCACTAGG + Intronic
1101461888 12:104905450-104905472 GCCCCGGTGCGGGATCCACTAGG - Intronic
1101603929 12:106233452-106233474 CCCCTGGTGCGGGATCCACTGGG + Intergenic
1102047747 12:109840347-109840369 GCCCCTGTGTGGCATTCACTGGG - Intergenic
1102309839 12:111836075-111836097 GCCCGGGTGCAGGATCCACTGGG + Intergenic
1102387176 12:112519870-112519892 GCCCTGGTGCAGGATCTACTGGG - Intergenic
1102904089 12:116661103-116661125 GGCCCAGTACGGGATCCACTGGG + Intergenic
1103146069 12:118597114-118597136 GCCCTGGTGCGGGATCCACCGGG - Intergenic
1103439142 12:120950264-120950286 GCCCCAGTGGGAGATCCACTGGG - Intergenic
1103497631 12:121374861-121374883 GCTCCTGTGCGGGATCCACTGGG + Intronic
1103668625 12:122592447-122592469 CCCTTGGTGCGGGATCCACTAGG + Intronic
1103678640 12:122676575-122676597 GCTCCAGGGCAGGATCCACTGGG - Intergenic
1103783314 12:123414051-123414073 GCCCCGGTGCGGGATCCACTGGG - Exonic
1103853365 12:123947383-123947405 GCCCCGGTGTGGGATCCACTGGG + Intronic
1104127511 12:125861773-125861795 GCGCCTGCGCAGGATCCTCTTGG - Intergenic
1104344575 12:127983807-127983829 GCCCTGGTGCGGGATCCACTGGG + Intergenic
1104373964 12:128247670-128247692 GCCCTCGCACGGGATCCACTAGG + Intergenic
1104582717 12:130022477-130022499 GCCCCGGTGCGGGATCCACTAGG + Intergenic
1104614440 12:130256592-130256614 ACCCCAGTGCGGGATCCACTAGG - Intergenic
1104749320 12:131228234-131228256 GCCCCGGTGCGGGATCCACTGGG + Intergenic
1105037828 12:132939176-132939198 GCCCCGGTGCGGGATCCACTAGG + Intronic
1105477320 13:20739869-20739891 GCCCCAGTGCTGGATCCACTAGG - Intronic
1105605092 13:21920640-21920662 GCCCCAGTGCGGTATCCACTGGG - Intergenic
1105697153 13:22900387-22900409 GCCCTGTTGCGGGATCCACTGGG - Intergenic
1105701463 13:22938566-22938588 GCCCTGGCACGGGATCCACTAGG - Intergenic
1105722247 13:23127993-23128015 GCCCCAGTGCGGGATCCACTGGG + Intergenic
1105762075 13:23524507-23524529 GCCCCGATGTGGGATCCACTAGG + Intergenic
1105763188 13:23531828-23531850 GCCCTGGAGCGGGATCCACTAGG + Intergenic
1105777567 13:23677777-23677799 GCCCCCGTGCGAGATCCATTAGG - Intergenic
1105876608 13:24560644-24560666 GCCCTGGTGCAGGATCCACTGGG - Intergenic
1106221246 13:27748251-27748273 GCCCCGGCGCGGGATCCAATGGG - Intergenic
1106600482 13:31182990-31183012 GCCCTGGTGAGGGATCCACTGGG - Intergenic
1106616989 13:31339603-31339625 GCCCCAGTGTGGGATCCACTAGG - Intergenic
1106643355 13:31608767-31608789 GCCCTGGTGCGGGATCCACTGGG - Intergenic
1106840722 13:33682512-33682534 GCCCCGGTGTGGGATCCACTAGG + Intergenic
1107259307 13:38472368-38472390 GCCCCAGTGCGGGATCCACTAGG - Intergenic
1107590386 13:41898517-41898539 GCCCTGGTGCGGGATCCACTGGG - Intronic
1107836194 13:44413997-44414019 GCCTCGGTGCGGGATCCACTGGG + Intergenic
1108099105 13:46935993-46936015 GCCCTGGTGTGGGATCCACTAGG - Intergenic
1108362235 13:49678271-49678293 GCCCTGGTGCGGGATCCACTAGG - Intronic
1108435422 13:50397011-50397033 GCCCCAGTGCAGGATCCACTGGG + Intronic
1108469381 13:50753245-50753267 GCCCTGGTGCGGGATCCACTGGG - Intronic
1108643899 13:52408013-52408035 GCCCCGGTGCGGGATCCACTGGG - Intergenic
1108686810 13:52826678-52826700 GCCCTGGTGCGGGATCCACTAGG + Intergenic
1108750192 13:53440070-53440092 GCCCCTGTGCAGGATCCACTAGG + Intergenic
1108751462 13:53452332-53452354 GCCCTGGTGCGGGATCCACTAGG - Intergenic
1108851540 13:54737214-54737236 GCCCCAGTGCGGGATCCACTAGG - Intergenic
1108856463 13:54799662-54799684 AGCCCTGTGGGGGATCCACTGGG - Intergenic
1108858882 13:54829438-54829460 GCCCCGGTGCGGGATCCACTGGG - Intergenic
1108991065 13:56659048-56659070 GCCCCAGTGTGGGATCCACTAGG - Intergenic
1108996078 13:56735985-56736007 GCCCCTGTGCGGGATCCACTGGG + Intergenic
1109007835 13:56901152-56901174 GCCCCAGTGCCAGAACCACTGGG + Intergenic
1109037651 13:57286526-57286548 ATCCCCGTGCAGGATCCACTAGG - Intergenic
1109110938 13:58318473-58318495 GCCCCAGTGGGGGATCCACTAGG - Intergenic
1109124643 13:58504209-58504231 GCCCTGGTGCGGGATCCACTAGG - Intergenic
1109124849 13:58505364-58505386 CCCCCTGTGCGTGATCCACTAGG - Intergenic
1109141123 13:58714505-58714527 GCCCCGGTGCGGGATCCACTAGG + Intergenic
1109159797 13:58958120-58958142 GCCCCGGTACGGGATCCACTGGG - Intergenic
1109201947 13:59440332-59440354 CAGCCTGTGTGGGATCCACTGGG + Intergenic
1109364709 13:61339582-61339604 GCCCCAGTGAGGGATCCACTGGG + Intergenic
1109441441 13:62379651-62379673 GCCCCGGTGCGGGATCCACTAGG + Intergenic
1109506221 13:63306154-63306176 GCCCCTGTGCCAGATCCACAAGG + Intergenic
1109563092 13:64077473-64077495 GCCCCGGTGCAGGATCCACTGGG - Intergenic
1109699730 13:66009650-66009672 GCTCCAGTGCAGAATCCACTGGG + Intergenic
1109741600 13:66561446-66561468 GCCCTGGTGTGGGATCCACTGGG + Intronic
1109745893 13:66622371-66622393 GCCCCGGTGCAGGAGCCACTGGG + Intronic
1109829878 13:67772875-67772897 GACCTGGTGCTGGATCCACTAGG - Intergenic
1109854219 13:68107657-68107679 GCCCCAGTGCAGGATCCACTGGG - Intergenic
1109858881 13:68171342-68171364 GCCCGGGTGTGGGATCCACTGGG + Intergenic
1110023994 13:70511849-70511871 GCTCTGGTGCGGGATCCACTGGG - Intergenic
1110064608 13:71087666-71087688 GCCCTGGTGCGGGATCCACTAGG + Intergenic
1110364122 13:74662210-74662232 GCCCCTCTGCTGGGTCCCCTTGG + Intergenic
1110368950 13:74718810-74718832 GCCCCGGTGCGGGATCCACTGGG + Intergenic
1110417553 13:75268871-75268893 GCCCCAGTATGGGATCCACTAGG + Intergenic
1110497925 13:76190514-76190536 GCCCTGGTGCAGTATCCACTAGG + Intergenic
1110609749 13:77475434-77475456 GCCCCTGTGCGGGATCCACTGGG - Intergenic
1110751323 13:79119575-79119597 GCCCCGGTGGAGGATCCACTGGG - Intergenic
1110792327 13:79600096-79600118 GCCCCAGTGCGGGATCTACTGGG - Intergenic
1110862213 13:80355959-80355981 GGCCCGGTGTGGGATCCACTGGG + Intergenic
1110874285 13:80490495-80490517 GCCCCAGTGCGGGATCCACCGGG - Intergenic
1110940215 13:81340709-81340731 GCCCCGGTGCGGGATCCACTGGG - Intergenic
1110999766 13:82164885-82164907 GCCCCAGTGTGAGATCCACTGGG - Intergenic
1111006720 13:82258381-82258403 GCCCCGGTGCGAGATCCGCTGGG + Intergenic
1111138720 13:84086352-84086374 GCCCTGGTACGAGATCCACTGGG - Intergenic
1111441980 13:88292242-88292264 GCCCCAGTGCAGGATCCACTGGG + Intergenic
1111556099 13:89883804-89883826 GGGCTGGTGCGGGATCCACTAGG - Intergenic
1111602797 13:90495194-90495216 GCCCCAGTGGGGTATCGACTGGG + Intergenic
1111747749 13:92291267-92291289 CGCCCTGTGCAGGATCCACTGGG + Intronic
1111748402 13:92297088-92297110 GCCCCTGTGCGGGATCCACTAGG + Intronic
1111841334 13:93454724-93454746 GCCCGGGTGCGGGATCCACTGGG - Intronic
1112077670 13:95931375-95931397 GCCCAGGTGTGGGATCCACTAGG - Intronic
1112226586 13:97545707-97545729 GCCCCCATGTGGGATCCACTGGG + Intergenic
1112282623 13:98076273-98076295 GCCCGGGTGCAGGATCCACTGGG - Intergenic
1112518721 13:100077938-100077960 GCCCTGGTGTGGGATCCACTGGG + Intergenic
1112533091 13:100223987-100224009 GCCCCGGTGCGGGATCCACTGGG - Intronic
1112613178 13:100976118-100976140 GCCCCGGTGCGGGATCCACTGGG + Intergenic
1112705928 13:102068896-102068918 GCCCCAGTGCAGGATCCACTAGG + Intronic
1112842763 13:103600361-103600383 GCCCTGGTGCGGGATCCACTGGG + Intergenic
1113482608 13:110632967-110632989 GCCCTGGTGCGGGATCCACTGGG - Intronic
1113506709 13:110821582-110821604 GCCTCGGTGTGGGATCCACTAGG + Intergenic
1113538055 13:111083810-111083832 GCCCCGGTGCGGGACCCACTAGG - Intergenic
1113678128 13:112222139-112222161 GCCTCGGTGTGGGATCCACTAGG + Intergenic
1113843045 13:113371264-113371286 TGCACTGTGCGGGCTCCACTGGG - Intergenic
1114559800 14:23581180-23581202 GGCCTGGTGGGGGATCCACTGGG + Intergenic
1114560236 14:23584819-23584841 GCCCCGGTGCAGGATCCACTAGG - Intergenic
1114593614 14:23892180-23892202 GCCCTGGTGGGGGATCCACTAGG + Intergenic
1114957844 14:27845796-27845818 GCCCCAGCGCGGGATCCACTAGG + Intergenic
1115118368 14:29909434-29909456 GCCTGGGTGCAGGATCCACTAGG + Intronic
1115174512 14:30547446-30547468 GCCCTGGGGCGGGATCCACTAGG - Intergenic
1115268552 14:31527022-31527044 GCCCCAGGGCAGGATCCACTAGG - Intronic
1115421273 14:33198677-33198699 GACCTGGTGCGGGATCCACTAGG - Intronic
1115533172 14:34345744-34345766 GCCCTGGTGCGGGATCCACTAGG - Intronic
1116114423 14:40629579-40629601 AGCCCCGTGCGGGATCCACTGGG - Intergenic
1116152043 14:41154187-41154209 GCCCTACCGCGGGATCCACTAGG - Intergenic
1116223116 14:42113431-42113453 GCCCCGGTGCAGGATCCACTGGG - Intergenic
1116250956 14:42482323-42482345 GCCCCGGTGCCGGATCCACTGGG - Intergenic
1116311081 14:43327025-43327047 GCCCCTGTGCAGGATCCACTAGG + Intergenic
1116390603 14:44385164-44385186 GCCCCGGTTGGGGATCCACTGGG + Intergenic
1116452439 14:45080858-45080880 GCCCCAGAGCGGGATCCACTGGG + Intergenic
1116624090 14:47242866-47242888 GCCCCGGTGTGGGATCCACTAGG + Intronic
1116653840 14:47626927-47626949 ACCCCGGTGCGGGATCCACTGGG + Intronic
1116657058 14:47665983-47666005 GCCCTGGTGCGAGATCCACTGGG + Intronic
1116901039 14:50362317-50362339 GGCCTGGTGTGGGATCCACTGGG + Intronic
1117077945 14:52122667-52122689 GCCCTGGTGCGGGATCCACTGGG + Intergenic
1117082664 14:52167165-52167187 GCCCTGGGGTGGGATCCACTAGG + Intergenic
1117297638 14:54393862-54393884 GCCCCGGTGCGGGATCCGCTGGG + Intergenic
1117449887 14:55839889-55839911 GCCCTGGTGTGGGATCCACTGGG + Intergenic
1117571851 14:57056554-57056576 GCCCCGGTGCGGGATCCACTAGG - Intergenic
1118215295 14:63803202-63803224 GCCCCGGTGGGGGATCCACTAGG - Intergenic
1118306387 14:64658550-64658572 GCCCCTGTGCGGTATCCACTGGG + Intergenic
1119027848 14:71167915-71167937 GCCCCAGTGCGGGATCCACTGGG + Intergenic
1119038921 14:71254719-71254741 GCCCCGGTGTGGGATCCACTGGG + Intergenic
1119300246 14:73566271-73566293 GCCCCAGTGCACGATCCACTGGG - Intergenic
1119303615 14:73590416-73590438 AACCCCGTGCGGCATCCACTGGG - Intergenic
1119486856 14:74994571-74994593 GCCCCAGTGCGGGATCCACTAGG + Intergenic
1119673367 14:76536688-76536710 GCCCCGGTGCGGGATCCACTGGG - Intergenic
1119870632 14:78013918-78013940 GCCCTGTTGCAGGATCCACTAGG - Intergenic
1120169765 14:81236503-81236525 TCCCAGGTGCAGGATCCACTAGG + Intergenic
1120209799 14:81623732-81623754 GGCACTGTGCAAGATCCACTGGG - Intergenic
1120331055 14:83092803-83092825 GCACCGGTGCGGGATCCACTGGG + Intergenic
1120439030 14:84512846-84512868 GCCCCGGTGTGGGATCCACTGGG - Intergenic
1120632230 14:86905362-86905384 GCCCCAGTGGGAGATCCACCAGG - Intergenic
1120704679 14:87734668-87734690 GCCCTGGTGCGAGATCCACTGGG - Intergenic
1120844235 14:89112070-89112092 GCCCCCGTGCAGAATCCACTGGG + Intergenic
1121145475 14:91578396-91578418 GCCCTGGCGTGGGATCCACTAGG + Intergenic
1121416571 14:93783411-93783433 TCCCCAGTGCTGGTTCCACTTGG + Intronic
1122216450 14:100208104-100208126 GCCCCAGTGCAGGAGCCACTGGG - Intergenic
1122493382 14:102135449-102135471 GCCCCGGTGCGGGATCCACTAGG - Intronic
1122514612 14:102298111-102298133 GCCCTGGTGTGGGATCCACTAGG + Intronic
1122894749 14:104751462-104751484 GCCCCGGTGTGGGATCCACTAGG - Intergenic
1123799218 15:23803336-23803358 GCCCAGGTGCGGGATCCGCTGGG + Intergenic
1123949055 15:25253131-25253153 GCCCCAGTGCGGGATCCACTGGG - Intergenic
1124036432 15:26057295-26057317 GCCCCAGTGCAGGATCCACTGGG + Intergenic
1124110541 15:26781607-26781629 ACCCCCGTGCGGGATCCACTGGG - Intronic
1124114774 15:26831117-26831139 GCCCTGGTGCGGGATCCACTGGG - Intronic
1124198513 15:27656386-27656408 GCCCAGGTGTGGGATCTACTGGG - Intergenic
1124366656 15:29076631-29076653 GCCCCTGTAGGAGATCCACTGGG + Intronic
1124387779 15:29224732-29224754 GGCCCGGTGCCGGATCCACTGGG - Intronic
1124562027 15:30783131-30783153 GCCCTGGCGTGGGATCCACTAGG - Intergenic
1124573204 15:30884179-30884201 GCCCCGGTGCGGGATCCACTAGG + Intergenic
1124818400 15:33019424-33019446 GCCCCGGTGCAGGATCCACTGGG - Intronic
1125112293 15:36047375-36047397 GCCCCGGTGCGGGATCCACTGGG + Intergenic
1125480215 15:40074711-40074733 GCCCCATTGCGGGATCCACTAGG - Intergenic
1125609775 15:40962041-40962063 GCCCCGGTGCGGGATCCACTAGG + Intergenic
1125885475 15:43226526-43226548 GCCCCAGTGCGGGATCCACTGGG - Intergenic
1125914480 15:43473810-43473832 GCCCCCGTGCGAGATCCACTGGG - Intronic
1126089068 15:45035257-45035279 GCCCCAGTGCGAGATCCACTGGG + Intronic
1126128161 15:45314520-45314542 GCCCCCATGCGGGATCCACTGGG + Intergenic
1126639749 15:50812391-50812413 GCCCCGATGCGGGATCCAGTGGG + Intergenic
1127211672 15:56780069-56780091 GCCCCGATGGGAGATCCACTGGG + Intronic
1127765990 15:62186502-62186524 GCCCTGGTGCAGGATCCACTGGG - Intergenic
1127916512 15:63459469-63459491 GCCCCGGTGCAGGATCCACGAGG + Intergenic
1128110917 15:65075447-65075469 GCCCTGGTGCAGGATCCACTAGG + Intronic
1128594029 15:68928893-68928915 GCCTGGGTGTGGGATCCACTGGG - Intronic
1128598493 15:68975607-68975629 GCCCCGGTGCGGGGTCCACTGGG - Intronic
1128669908 15:69567296-69567318 GCCCTGGTGCGGGATCCACTGGG - Intergenic
1128813231 15:70587112-70587134 GCCCTGGTGCGGGATCCACTGGG - Intergenic
1129158188 15:73732123-73732145 GTCCCGGTGGGGGATCCACTGGG - Intergenic
1129196998 15:73974131-73974153 GCCCCCGTGTGGGATCCACTGGG + Intergenic
1129208708 15:74052922-74052944 GCCCCCGTGCGGGATCCACTGGG + Intergenic
1129373938 15:75115934-75115956 GCCCCGGTGCAGGATCCACTGGG - Intronic
1129777426 15:78246075-78246097 GCCCGGGTGCGGGATCCACTGGG - Intergenic
1129859244 15:78847296-78847318 GCCCCCGTGCGGGATCCACTAGG + Intronic
1129986967 15:79926497-79926519 GCCCCGGTGCAGGATCCACTGGG + Intergenic
1129997219 15:80016900-80016922 GCCCCAGTGCGGGATCCACTGGG + Intergenic
1130132943 15:81159044-81159066 GCCCCGGTGCGGGATCCACTGGG + Intergenic
1130542795 15:84833893-84833915 GCCCCTGTGCTGGAGACAGTAGG - Intronic
1131012628 15:89031637-89031659 GCCCCGGTGCGGGATCCACTGGG - Intergenic
1131112030 15:89770548-89770570 GCCCAGTTGGGGGATCCACTTGG + Intronic
1131250323 15:90825895-90825917 GGCCCCGTGGGGGATCCACTGGG + Intergenic
1131472761 15:92711023-92711045 TCCCCGGTGTGGGATCCACGGGG - Intronic
1131507861 15:93032250-93032272 GCCCCGGTGCGGGATCCACTAGG + Intergenic
1131846034 15:96491770-96491792 GCCCCGGTGCGGGATCCACTGGG - Intergenic
1131892112 15:96984112-96984134 GCCCCTGTGCAGTATCCACTTGG - Intergenic
1131912673 15:97224669-97224691 GCCCCGGCGCGGAATCCACTAGG + Intergenic
1131992311 15:98104203-98104225 GCCCCGGTGCAGGATCCACTGGG - Intergenic
1132044279 15:98550135-98550157 GCCTCCGTGCAGGATCCACTGGG + Intergenic
1132097774 15:99000426-99000448 GCCCCAGTGCGGGATCCACAGGG + Intronic
1132098801 15:99008214-99008236 GCCCTGGTGCGGGATCCACTGGG - Intergenic
1132511092 16:341666-341688 ACCCCGGTGCGGGATCCACTGGG + Intronic
1132836739 16:1958138-1958160 GCCCCCGTGCGGGATCCACCGGG - Intergenic
1133098746 16:3466253-3466275 GCCACTCTGCGGGCTCCCCTCGG + Intronic
1133352091 16:5108489-5108511 GCCCCAGGGCGGGATCCACTTGG - Intergenic
1133362581 16:5186302-5186324 GCCCCGGTGCGGGATCCACTGGG - Intergenic
1133367458 16:5221948-5221970 GCCCCGGTGCAGAATCCACTGGG - Intergenic
1134678071 16:16104606-16104628 GCCCCAGTGTGGCATCCACCTGG - Intronic
1135262048 16:20989580-20989602 GCCCCGGTGCGGGATCCACTAGG - Intronic
1135280935 16:21153020-21153042 GCCCCGGTGCAGGAGCCACTGGG + Intronic
1135299319 16:21312718-21312740 GCCCTGGTGCGGGATCCACTAGG - Intergenic
1135470144 16:22722930-22722952 GCCCTGGTGCGGGATCCACTGGG - Intergenic
1135942624 16:26836037-26836059 GCCCTGGTGCAGGATCCACTGGG - Intergenic
1136163373 16:28435791-28435813 GCCCCGGTGCGGGATCCACTGGG + Intergenic
1136199590 16:28679196-28679218 GCCCCGGTGCGGGATCCACTGGG - Intergenic
1136215936 16:28793369-28793391 GCCCCGGTGCGGGATCCACTGGG - Intergenic
1137442588 16:48509110-48509132 GCCCCGGTGCGGGATCCACTGGG + Intergenic
1138168914 16:54830237-54830259 GGCCCAGTGCAGGATCCACTAGG + Intergenic
1138693526 16:58790707-58790729 GCCCCGGTGTGGGATCCACTGGG - Intergenic
1138889795 16:61128698-61128720 GCCCCAGCATGGGATCCACTAGG - Intergenic
1139125464 16:64072266-64072288 GCCCTGGTGCGGGATCCACTGGG - Intergenic
1139147814 16:64344315-64344337 GCCCCAATGCGAGATCCACGGGG + Intergenic
1139383233 16:66547765-66547787 GCTCCTGTGTGGGATGCACTGGG - Intronic
1139442381 16:66974651-66974673 GCCCCAGTGCTGGATCCACTGGG + Exonic
1139600359 16:67982645-67982667 GCCCCGGTGCAGCATCCACTGGG + Intergenic
1139603132 16:67998638-67998660 TCCCTGGTGCGGGATCCACTGGG + Intronic
1139676485 16:68527123-68527145 GCCCCGGTGCGGGATCCACTGGG + Intergenic
1140722444 16:77784322-77784344 GCCCCCATGCGGGATCCACTAGG - Intergenic
1141465667 16:84204553-84204575 GCCCCGGTGCGGGATCCACCAGG - Intergenic
1141837759 16:86553777-86553799 GCCCCAGTGCGGGATCTGCTGGG + Intronic
1142050434 16:87954634-87954656 TCTCCTGTGCGGGACCGACTTGG + Intronic
1142505742 17:362016-362038 GCCCCGGTGCGGGATCCACTAGG + Intronic
1143135200 17:4709034-4709056 GCCCCCAAGCGGGATCCACTGGG - Intergenic
1143283441 17:5771639-5771661 GCCCCGGTGCGGGATCCACTGGG + Intergenic
1143460440 17:7100530-7100552 GCCCCAGTGCAGGATCCATGGGG - Intergenic
1143552801 17:7641258-7641280 GGCCTGGTGCTGGATCCACTGGG + Intergenic
1143664200 17:8347056-8347078 GCCCCGGTGTGGGATCCACTGGG - Intergenic
1143708576 17:8718015-8718037 GCCCCAGTGCGGGATCCACTGGG - Intergenic
1144467223 17:15506111-15506133 GCCCCGGTGCGGGATCCACTAGG + Intronic
1144723281 17:17486775-17486797 GCCCCGGTGCGGGATCCACTAGG + Intronic
1144804600 17:17956434-17956456 ACCCAGGTGTGGGATCCACTGGG - Intronic
1145050221 17:19654250-19654272 GCCCCGGCGTGGGATCCACTAGG - Intronic
1146740383 17:35278851-35278873 GCCCTGGTGGGGGATCCACTGGG - Intergenic
1147137902 17:38444635-38444657 CCCCCTGTGCGGGGACCTCTAGG + Intronic
1147373699 17:40011357-40011379 GCCCTGGTGCGGAATCCACTGGG + Intergenic
1147431890 17:40376252-40376274 GCCCTGGTGCGGGATCCACTGGG + Intergenic
1147805422 17:43127219-43127241 AGCCCTGCGCAGGATCCACTAGG + Intergenic
1147997609 17:44369226-44369248 GCCCCTGTGCGGGATCCACTGGG + Intergenic
1148016951 17:44528396-44528418 GCCCCGGTGCAGGATCCACTGGG + Intergenic
1148023446 17:44568607-44568629 GCCCCGATGCGGGATCCACTGGG + Intergenic
1148366103 17:47057222-47057244 GCCCCAGTGCGGGATCCACTGGG - Intergenic
1148991318 17:51669163-51669185 GGCCCAGTGTGGGATCCACTAGG + Intronic
1149099185 17:52883913-52883935 GCCCTGGTGCGGCATCCACTGGG - Intronic
1149754048 17:59172942-59172964 CTCCCGGTGCGAGATCCACTGGG + Intronic
1150682583 17:67295133-67295155 GCCTTGGTGCAGGATCCACTGGG + Intergenic
1150772353 17:68052294-68052316 ACCCCGCTGTGGGATCCACTGGG + Intergenic
1150775889 17:68081037-68081059 GCCCCCATGTGGGATCCACTGGG + Intergenic
1150786686 17:68169296-68169318 ACCCCGGTGCAGGATCCACTAGG - Intergenic
1150788352 17:68180275-68180297 GCCCCCGTGCGAGACCCACTGGG + Intergenic
1150792309 17:68208236-68208258 GCCCCAGTGCGGGATCCACTGGG + Intergenic
1150804533 17:68308850-68308872 GCGCCGGTGCGGGATCCACTGGG - Intronic
1151567391 17:74906981-74907003 GCCCCGGTGCAGGATCCACTAGG - Intergenic
1151672781 17:75580922-75580944 GCCCTGGTACTGGATCCACTGGG + Intergenic
1151782596 17:76257585-76257607 GCCCCAGTGCGGGATCCACTGGG - Intergenic
1151866508 17:76806537-76806559 GGCCCAGTGTGGGATCCACTGGG + Intergenic
1152618968 17:81351971-81351993 GCCCCAGTGCGAGATCCACTGGG - Intergenic
1153070462 18:1098654-1098676 GCCCCTGTGCGGGATCCACTGGG + Intergenic
1153752318 18:8245347-8245369 GCACCTGTGCATGCTCCACTGGG - Intronic
1153832387 18:8935361-8935383 GCCCTGGTGCGGGATCCACTAGG - Intergenic
1154057161 18:11023587-11023609 GCCCCGGTGCGGGATCCACTGGG - Intronic
1154128685 18:11716884-11716906 GCCCCCGTGCGGGATCCACTGGG - Intronic
1154231080 18:12557084-12557106 GCCCCAACGCGGGATCCACTAGG - Intronic
1154231351 18:12559019-12559041 GCCCTGGTGCAGGATCCACTAGG - Intronic
1154255233 18:12776784-12776806 GCCCTGATGCGGGATCCACTGGG - Intergenic
1154294039 18:13134623-13134645 GCCCCACTGTGGGATCCACTAGG - Intergenic
1155003398 18:21706937-21706959 GCTCCCCTGTGGGATCCACTAGG + Intronic
1155207971 18:23577567-23577589 GCCCCGGTGCGGGATCCACTAGG - Intronic
1155271881 18:24149489-24149511 TCCCCAGTGCAGGATCCACTGGG - Intronic
1155294958 18:24376517-24376539 GCCCCAGTGCGGGATCCACTGGG - Intronic
1155611637 18:27673826-27673848 GCCCTGGTGCGAGATCCACTGGG - Intergenic
1155772948 18:29723940-29723962 GCCCCGGTGTGGGATCCACTAGG + Intergenic
1155852351 18:30788868-30788890 GCCCTGGTGTGGGATTCACTGGG + Intergenic
1155856305 18:30839096-30839118 GCCCCAGTGAGGGATCCACTAGG - Intergenic
1156038747 18:32794996-32795018 GCCCCGGTGCGGGATCCACTGGG + Intergenic
1156079569 18:33316580-33316602 GCCCCAGTGGGAGATCCACTGGG + Intronic
1156488959 18:37485331-37485353 GCCCCTGTCCCGGATCCCGTTGG + Intronic
1156683646 18:39618887-39618909 GCCCTGGTGCAGGATCCGCTAGG + Intergenic
1156943244 18:42795652-42795674 GCCCGGGTGCGGGATCCACTGGG + Intronic
1156969750 18:43139942-43139964 GCCCCAGTGCGGGATCCACTGGG + Intergenic
1157086041 18:44581156-44581178 GCCCCGGTGTGGGATCCACTAGG + Intergenic
1157661897 18:49452780-49452802 GCCCTGGTGCAGGATCCACCAGG + Intronic
1157856831 18:51111781-51111803 GCCCCGGTGCGGGATCCACTGGG - Intergenic
1157935116 18:51864303-51864325 GCCCCAGTGCAGGATCCATTAGG - Intergenic
1157979724 18:52366841-52366863 GCCCTGGTGCGGGATCCACTGGG - Intronic
1158351999 18:56572713-56572735 GCCCTGGTGTGGGATCCACTGGG + Intergenic
1158460662 18:57643597-57643619 GCCCTGGTGCAGGATCCACTGGG - Intergenic
1158553958 18:58459797-58459819 GCACCGGTGCGGGATCCACTGGG + Intergenic
1158697185 18:59714030-59714052 GCCCCGGTGCGGGATCCACTAGG - Intergenic
1158705679 18:59790393-59790415 GCCCCGGTGCGGGATCCACTAGG - Intergenic
1159109879 18:64043402-64043424 AGCCCGGTGCAGGATCCACTAGG + Intergenic
1159167879 18:64725577-64725599 GCCCCAGTGCGGGATCCACTGGG - Intergenic
1159230881 18:65605676-65605698 GCCCCGGTGCGGGATCCACTGGG + Intergenic
1159260408 18:66005901-66005923 GGTGCGGTGCGGGATCCACTAGG - Intergenic
1159472869 18:68879933-68879955 GCCCTGGTGCGGGATCCACTGGG - Intronic
1159656030 18:71031275-71031297 GCCCTGGTGCGGGATCCACTAGG - Intergenic
1159744034 18:72209550-72209572 GCCCCGGTGCAGGATCCACTGGG + Intergenic
1160176543 18:76600068-76600090 GCCCCGGTGCGGGATCCACTAGG - Intergenic
1160198631 18:76777667-76777689 GCCCCGGTGCGGGATCCACTAGG + Intergenic
1160783818 19:890723-890745 CCCCGTGTGCGGGATCGAATCGG - Intronic
1162107074 19:8376187-8376209 GCCCCGGTGCAGGATCCACTGGG + Intronic
1162230221 19:9259936-9259958 GCCCCGGTGCAGGATCCACTGGG + Intergenic
1162233031 19:9283390-9283412 GCCCCAGTGCGGGATCCACTGGG - Intergenic
1162237824 19:9322019-9322041 GCCCCAGTGCAAGATCCACTGGG + Intergenic
1162261983 19:9541264-9541286 GCCCCAGTGCGGGATCCACTGGG - Intergenic
1162632627 19:11941233-11941255 GCCCTGGTGCAGGATCCACTGGG - Intronic
1162814649 19:13186641-13186663 GCCCCGGTGCAGGATACACTGGG - Intergenic
1163181650 19:15608584-15608606 GCCCTGCTGCGGGATCCACTGGG - Intergenic
1163218926 19:15900106-15900128 GCCCCGGTGCGGGATCCACTGGG + Intergenic
1164143958 19:22498926-22498948 GCCCCGGTGCGGGATCCACTGGG - Intronic
1164270517 19:23668465-23668487 GCCCCGGTGCGGGATCCACTGGG - Intronic
1164310532 19:24041737-24041759 GCCCCGGTGCGGGATCCACTAGG + Intronic
1164582042 19:29440439-29440461 GCCCCAGCGCAGGATCCACTAGG + Intergenic
1164975869 19:32572007-32572029 GCCCCGGTGAGGGATCCACTGGG + Intergenic
1165036457 19:33037024-33037046 GCCCTGGTGTGGGATCCACTGGG + Intronic
1165266997 19:34668568-34668590 GCCCCGGTGCGGGATCCACTGGG + Intronic
1165415459 19:35691034-35691056 GCCCCAGTGCGGGATCCACTGGG - Intergenic
1165774374 19:38396064-38396086 GCCCCTGCGCGCGTGCCACTGGG + Exonic
1165846656 19:38821890-38821912 GCCCTGGTGCAGGATCCACTGGG + Intronic
1166036142 19:40170078-40170100 GCCCCAGTGCGGGATCCACTGGG - Intergenic
1166486938 19:43221859-43221881 GCCCCAGTGTGGGATCCACTGGG - Intronic
1166649661 19:44563179-44563201 GCCCCGGTGCGAGATCCACTAGG - Intergenic
1167699134 19:51032063-51032085 GCCGCTGTGCCGGATCTGCTCGG + Exonic
1168659964 19:58157729-58157751 GGCCCTGTGCGGGATCCACTGGG + Intergenic
924967447 2:91412-91434 GCCCCAGTGTGGGTACCACTGGG + Intergenic
925088617 2:1134663-1134685 GCCCCGGTGGGGGATCCACTGGG - Intronic
925098901 2:1229536-1229558 GCCCCGGTGCCGGATCCACTGGG - Intronic
925130373 2:1489963-1489985 CCCCCTGTGTGGGACCCACGTGG - Intronic
925130413 2:1490163-1490185 CCCCCTGTGTGGGACCCACGTGG - Intronic
925130432 2:1490263-1490285 CCCCCTGTGTGGGACCCACGTGG - Intronic
925130452 2:1490363-1490385 CCCCCTGTGTGGGACCCACGTGG - Intronic
925172520 2:1759239-1759261 GCCCTGGCGTGGGATCCACTAGG - Intergenic
925533051 2:4884630-4884652 GCCGTGGTGAGGGATCCACTAGG + Intergenic
925537734 2:4935252-4935274 GCCCCGGTGCGGGATCCACTGGG - Intergenic
926097565 2:10091840-10091862 GCCCTGGTGCGACATCCACTGGG + Intergenic
926437597 2:12854031-12854053 GCTCCCGTCCAGGATCCACTAGG - Intergenic
926474692 2:13308243-13308265 GGGTCTGGGCGGGATCCACTGGG - Intergenic
926476013 2:13323408-13323430 GCCCTTGTGCAGCATCCAGTAGG - Intergenic
926616555 2:15002472-15002494 GTCCCGGTGCGGGATCCACTGGG - Intergenic
926685767 2:15696712-15696734 ACCCCAGTGCAGGATCCACTGGG - Intronic
926850722 2:17193934-17193956 GCCCCTGTGCCGGATCCACTGGG + Intergenic
927357151 2:22186721-22186743 GCCCCAGTGCGGGATCCACTGGG + Intergenic
927777868 2:25915884-25915906 GCCCCCGTGGGGGATCCACTGGG + Intergenic
927900480 2:26814782-26814804 GCCCTGGTGCGGGATCCACTGGG + Intergenic
927942119 2:27111451-27111473 GCCCCGGTGCAGGATCCACTGGG - Intronic
928106428 2:28473054-28473076 GCCCCAGTGCAGGATCCACTGGG + Intronic
928493141 2:31804062-31804084 AGCCCCGGGCGGGATCCACTGGG + Intergenic
928599119 2:32886510-32886532 GCCCCGGCGCAGCATCCACTAGG - Intergenic
928617869 2:33057364-33057386 GCCCCAGTGGGAGACCCACTGGG - Intronic
928723042 2:34142472-34142494 GCCCTGGCGTGGGATCCACTAGG - Intergenic
928753270 2:34494716-34494738 GCCCTGGTGCGGGATCCACTAGG + Intergenic
928880653 2:36092663-36092685 GCCCCGGTGCGGGATCCACTAGG + Intergenic
928936976 2:36688683-36688705 GCCCCGGTGCGGGATCCACTGGG + Intergenic
929109938 2:38397685-38397707 ACCCTGGTGTGGGATCCACTTGG + Intergenic
929137945 2:38643008-38643030 GCCCTGGGGAGGGATCCACTAGG - Intergenic
929233785 2:39585778-39585800 GCCCCGGTGCGGGATCCACTGGG + Intergenic
929379764 2:41336013-41336035 GCCCTGGTGCGGGATCCACTGGG + Intergenic
929890791 2:45917608-45917630 GCCCCAGTGCGGGATCCACTGGG - Intronic
930038090 2:47100155-47100177 GCCCTGGTGTGGGATCCACTGGG + Intronic
930039290 2:47107702-47107724 GCCCTGGTGCGGGATCCACTGGG + Intronic
930420806 2:51151552-51151574 GCCCCAGTGTGGGGTCCACTAGG - Intergenic
930468155 2:51780273-51780295 GCCCCGGTGCAGGATCCACTGGG - Intergenic
930485588 2:52007231-52007253 GCCCCGGTTTGGGATCCACTGGG + Intergenic
930605236 2:53486452-53486474 GCCCCAGTGCAGGATCCACTAGG + Intergenic
931708766 2:64969427-64969449 GCCCCAGAGTGGGATCCACTGGG + Intergenic
932178353 2:69622463-69622485 GCCCTGGTGCAAGATCCACTGGG + Intronic
932240004 2:70148728-70148750 GCCCCAGTGTGGGATCCACTGGG + Intergenic
932359449 2:71092425-71092447 GCCCCCATGCAGGATCCAGTGGG - Intergenic
932486552 2:72087304-72087326 GCCCCGGTGCGGGATCCACTAGG + Intergenic
932521848 2:72422249-72422271 GCCCCAGTGCGGGATCCACTAGG + Intronic
932902121 2:75711997-75712019 GCCCCGGTGCGGGATCCACTAGG + Intergenic
933060767 2:77734717-77734739 GCCCCGGTGCCGGATCCACTGGG - Intergenic
933415895 2:81985580-81985602 GCCCCTGCACGGGATCCACTAGG + Intergenic
933442023 2:82326221-82326243 GCCCCGGTGCGGGACCCACTGGG - Intergenic
933487179 2:82938379-82938401 GCCCTGGTGCGGGATCCAGTAGG - Intergenic
933490974 2:82985645-82985667 ACCCTGGTGCAGGATCCACTAGG - Intergenic
933506388 2:83181422-83181444 GCCCCGGTGCGGGATCCACTGGG + Intergenic
933511393 2:83245904-83245926 GCCCCCATGCGGGATCCACTGGG - Intergenic
933712084 2:85334351-85334373 GCCCTAGTGCGGGATCCACTGGG - Intergenic
934479459 2:94622138-94622160 GCCCCAGCGCGGGATCCGCTAGG - Intergenic
934898568 2:98139425-98139447 GCCCCTGTGTGGGATCCACTGGG + Intronic
935872771 2:107469365-107469387 GCCCTGGTGCAGGATCCACTAGG - Intergenic
935878292 2:107536028-107536050 GCTCCCATGCGGGATCCACTAGG - Intergenic
935896769 2:107747278-107747300 GCCCCGGTGCGGGATCCACTGGG - Intergenic
935922629 2:108031967-108031989 GCCCTGGTGCAGGATCCACTAGG + Intergenic
936172635 2:110190170-110190192 GCCCTGGTGCGGGATCTGCTGGG - Intronic
936346965 2:111682273-111682295 GCCCCGGTGCAGGATCCACTGGG + Intergenic
936581446 2:113704360-113704382 GCCCCTGTGCGGGATCCGCTGGG - Intergenic
937209522 2:120259688-120259710 GCCCCGGTGCGGGATCCACTAGG - Intronic
937596922 2:123684198-123684220 GCCCCGGTGTGGGATCCACTAGG + Intergenic
937711772 2:124987348-124987370 TCCCCGGTGCAGGATCCACTGGG - Intergenic
937746669 2:125422671-125422693 GCCCCAGTGTGGGATCCACTAGG + Intergenic
937789366 2:125942867-125942889 GTCCTGGTGCGGGATCCACTAGG - Intergenic
937867792 2:126767058-126767080 TCCCCTCTGCAGGATCCTCTAGG + Intergenic
938126004 2:128672060-128672082 GCCCCGGTGCAGGATCCACTGGG - Intergenic
938401099 2:130991867-130991889 GCCCCGGTGCGGGATCCACTGGG + Intronic
938725954 2:134109284-134109306 GCCCCGCTGCAGGATCCACTGGG - Intergenic
938931137 2:136088006-136088028 TCCCCCGTGGGGGATCCACTGGG - Intergenic
939003202 2:136758843-136758865 GCCCCTGTGCGGGATCCACTGGG + Intergenic
939053143 2:137331545-137331567 GCCCCAGTGCTGGATCCACTGGG - Intronic
939085751 2:137716216-137716238 GCCTTGGTGCAGGATCCACTAGG + Intergenic
939229839 2:139410764-139410786 GCCCCGGTGCGGGATCCACTGGG + Intergenic
939281829 2:140074202-140074224 GCCCAGGTACGGGATCCACTGGG + Intergenic
939465208 2:142546483-142546505 GCCCAGGTGTGGGATTCACTGGG + Intergenic
939509550 2:143089535-143089557 ACCCCAGTGCAGGATCCACTGGG - Intergenic
939738696 2:145880841-145880863 GCCCCAGTGCGGGATCCACTGGG - Intergenic
939745347 2:145960511-145960533 GCCCTGGTGTGGGATCCACTAGG - Intergenic
939777286 2:146403629-146403651 GCCCCAGTGCGGGATCCACTAGG - Intergenic
939972474 2:148678338-148678360 GCCCTGGTGCGGGATCCACTGGG - Intronic
940112586 2:150171039-150171061 GCCCCAGTTCGGGATCCACTGGG - Intergenic
940145589 2:150542260-150542282 GCCCCTGTGTGAGATCCACTGGG - Intergenic
940215167 2:151296379-151296401 GCCCCCGTGCAGGATCCAGCTGG + Intergenic
940666630 2:156617972-156617994 GCCCCAGTGCGGGATCCACTGGG - Intergenic
940784534 2:157967852-157967874 GGCTCCGTGGGGGATCCACTGGG - Intronic
941178998 2:162235337-162235359 GCTCCGGTGCGAGATCCACTGGG + Intronic
941240163 2:163026699-163026721 GCCCCGGTGCGGGATCCACTGGG + Intergenic
941309323 2:163909947-163909969 GCCCCAGTGCGGGATCCAATGGG + Intergenic
941309860 2:163914040-163914062 GCCCTGGTGCGGGATCCACTGGG + Intergenic
941397854 2:164994692-164994714 GCCCCCGTGCGGGATCCACTGGG - Intergenic
941486294 2:166086432-166086454 GCCCCTTTGTGGGATCCATGTGG - Intronic
941705798 2:168657376-168657398 GCCCCGGTGCGGGATCCACTAGG - Intronic
941820865 2:169841956-169841978 GCCCCGGTGCGGGATCCACTAGG + Intronic
942170182 2:173282530-173282552 GCCCCTGTGCGAGATCCACTAGG - Intergenic
942317518 2:174709507-174709529 GCCCCGGTGCGAGATTCACTGGG - Intergenic
942368584 2:175256939-175256961 GCCCCAGCGCGGGATCCACTAGG - Intergenic
942540265 2:177008273-177008295 GCCCTGGTGTGGGATCCACTGGG + Intergenic
942620084 2:177836094-177836116 GCCCCAGTGCGGGATCCACTAGG + Intronic
942867362 2:180691810-180691832 GCCCCCGTGCAGGATCCACTGGG + Intergenic
943024286 2:182608819-182608841 GCTCTGGTGCGGGATCCACTGGG + Intergenic
943106087 2:183546616-183546638 GCCCCAGTGCAGGATCCACTGGG - Intergenic
943134516 2:183892958-183892980 GCCCTGGTGCAGGATCCATTAGG + Intergenic
943443375 2:187952138-187952160 GCCCTGGCGCGGGACCCACTAGG + Intergenic
943494672 2:188606332-188606354 GCCCTGGTGCGGGATCCACTAGG - Intergenic
943516279 2:188891002-188891024 GCCCTGGCACGGGATCCACTAGG + Intergenic
943520544 2:188944372-188944394 GCCCTGGCGCAGGATCCACTAGG - Intergenic
943559282 2:189441705-189441727 GCGCCTGTGGGGGATCCCCAGGG + Intronic
943680265 2:190760888-190760910 GCCCCGGTGCGGGATCCACGAGG - Intergenic
943790106 2:191922010-191922032 GCCCCGGTGCGGGATCCACTGGG + Intergenic
943835228 2:192508391-192508413 GCCCCAGTGCGGGATCCACTAGG + Intergenic
943906048 2:193502399-193502421 GCCCGGGTGCAGGATCCACTGGG - Intergenic
943941379 2:194002695-194002717 GCCCCAAAGCGGGATCCACTGGG - Intergenic
943942798 2:194020583-194020605 GCCCCAGTGTGGGATCCACAGGG + Intergenic
943947794 2:194090329-194090351 GCCCTAGCGCTGGATCCACTAGG - Intergenic
943955027 2:194176786-194176808 GCCCCAGTGGGAGATCCAATGGG + Intergenic
944055248 2:195516049-195516071 GGCCTGGTGCGAGATCCACTGGG + Intergenic
944058417 2:195547289-195547311 GCCCCAGTGTGAGATCCACTGGG - Intergenic
944228512 2:197370989-197371011 GGCCCGGTGCCGTATCCACTGGG + Intergenic
944252414 2:197591492-197591514 GCCCCAGTGCAGTATCCACTGGG - Intronic
944482868 2:200175162-200175184 ACCCTGGTGCGGGATCCACTGGG + Intergenic
944729714 2:202503793-202503815 GCCCAGGTGTGGGATCCACTGGG + Intronic
944843070 2:203642804-203642826 GCCCTGGTGCGGGATCCATTGGG - Intergenic
944857856 2:203785511-203785533 GCCCCGGTGCGGGATCCACTGGG - Intergenic
945069705 2:205977607-205977629 GCCCCTGTGCGGGATCCACTGGG + Intergenic
945401459 2:209387757-209387779 GCCCCAGTGCGAGATCCACTGGG + Intergenic
945451421 2:210000554-210000576 GCCCCAGTATGGGATCCACTGGG - Intergenic
945575399 2:211524315-211524337 GCCCCCGTGAGGGATCCACTGGG - Intronic
945664148 2:212721007-212721029 GCCCCAGCGCAGGATCCACTAGG - Intergenic
945744295 2:213701649-213701671 GCCCTGGCGCAGGATCCACTAGG + Intronic
945745854 2:213718914-213718936 GCCCTGGTGCGGGATCCACTAGG + Intronic
945869223 2:215208296-215208318 GCCCTGGCGTGGGATCCACTAGG + Intergenic
945870291 2:215219485-215219507 GCCCCAGTGTGAGATCCACTGGG + Intergenic
945872756 2:215245678-215245700 GCCCCGGTGCGGGATCCACTGGG - Intergenic
946054067 2:216885646-216885668 GCCCCAGTGTGGTATCCACTGGG + Intergenic
946358012 2:219201365-219201387 GCCACGGTGCGGTATCCACTAGG - Intronic
946376573 2:219313199-219313221 GCCCCGGTGTGGGATCCACTGGG + Intergenic
946923489 2:224603639-224603661 GCCCTGGTGCGGAATCCACTGGG - Intergenic
946982090 2:225229386-225229408 GCCCCGATGCGGGATCCACTGGG - Intergenic
947026709 2:225744556-225744578 GCCCTGGTGCGGGATCCACTGGG + Intergenic
947103869 2:226648434-226648456 GCCCAGGTGTGAGATCCACTGGG + Intergenic
947171982 2:227321046-227321068 GCCCCAGCACAGGATCCACTAGG + Intergenic
947412064 2:229851139-229851161 GCCCCGGTGCAGGATCCACTGGG + Intronic
947931982 2:233972406-233972428 GCCGCGGTGCGGGATCCACTGGG - Intronic
947937951 2:234024215-234024237 GCCCTGGTGTGAGATCCACTGGG - Intergenic
948024686 2:234767546-234767568 GCCCCTTTGCTGGAGCTACTTGG + Intergenic
948449037 2:238057791-238057813 GCCGCAGTGGGGGATCCACTGGG - Intronic
1169630153 20:7622388-7622410 GCCCTGGCACGGGATCCACTAGG - Intergenic
1169645279 20:7803497-7803519 GCTCTCCTGCGGGATCCACTGGG - Intergenic
1169814382 20:9641527-9641549 GCCCCGGTGCGGGATCCACTAGG - Intronic
1169849264 20:10032101-10032123 GCTCTCGTGCGGGATTCACTGGG + Intronic
1170230811 20:14044766-14044788 GCCCCAGTGCGGGATCCACTGGG - Intronic
1170246544 20:14226929-14226951 GCCCCAGTGCAGGATCCACTGGG + Intronic
1170649575 20:18227187-18227209 GCCCTGGTGCTGGATCCACTGGG + Intergenic
1170806773 20:19639566-19639588 GCCCCAGTGCGGGATCCACTGGG - Intronic
1170930973 20:20768869-20768891 GCCCTGGCCCGGGATCCACTAGG + Intergenic
1170989967 20:21292302-21292324 GCCCCGGTGCGGGATCCACTGGG + Intergenic
1171175575 20:23049174-23049196 GCCCCTGCGCGGCTTCCAGTGGG - Exonic
1171869535 20:30514147-30514169 GCACCTGTGGCGGATCCACCTGG + Intergenic
1171973343 20:31578506-31578528 GCCCCTGTGCGGGATCCACAGGG - Intergenic
1172431777 20:34898739-34898761 GCCCCAGTGCGGGATCCACTGGG - Intronic
1173195456 20:40910407-40910429 GCCCCAGTGCGGGATCCACTAGG - Intergenic
1173195762 20:40911606-40911628 GCCCCAGTGCGGGATCCACTAGG + Intergenic
1173601673 20:44299557-44299579 GCCCCGGTGCGGGATCCACTGGG + Intergenic
1173778845 20:45736314-45736336 GCCCCAGAGCGGGACCCACTGGG + Intergenic
1174162818 20:48564047-48564069 GCCCCAGTATGGGATCCACTGGG - Intergenic
1175210146 20:57348820-57348842 GCCCCGGTGCGGGATCCACTGGG + Intergenic
1175254225 20:57629211-57629233 GCCCCGGGGCAGGATCCACTGGG + Intergenic
1176189447 20:63800955-63800977 GCCCCAGTGCCGGATCCACTCGG + Intronic
1176332228 21:5559589-5559611 GACCCTGTGGGGGATCCACTGGG - Intergenic
1176344762 21:5733446-5733468 GCCCTGGTGCGGGATCCACTGGG - Intergenic
1176351576 21:5854030-5854052 GCCCTGGTGCGGGATCCACTGGG - Intergenic
1176395529 21:6261362-6261384 GACCCTGTGGGGGATCCACTGGG + Intergenic
1176441628 21:6727742-6727764 GACCCTGTGGGGGATCCACTGGG - Intergenic
1176465890 21:7054811-7054833 GACCCTGTGGGGGATCCACTGGG - Intronic
1176489451 21:7436589-7436611 GACCCTGTGGGGGATCCACTGGG - Intergenic
1176500065 21:7591009-7591031 GCCCTGGTGCGGGATCCACTGGG + Intergenic
1176539083 21:8131516-8131538 GCCCTGGTGCGGGATCCACTGGG - Intergenic
1176558034 21:8314561-8314583 GCCCTGGTGCGGGATCCACTGGG - Intergenic
1176663294 21:9660424-9660446 GCCCTGGTGCAGGATCCACTGGG + Intergenic
1176663654 21:9664009-9664031 GGCCAGGTGCGGGATCCACTAGG - Intergenic
1176671113 21:9735959-9735981 GCCCCAGTGCGGGATCCACTGGG + Intergenic
1176872176 21:14092903-14092925 GCCCCTGTGCGAGATCCACTGGG - Intergenic
1176966542 21:15218513-15218535 GTCCCGGTGCGGGATCCACTAGG - Intergenic
1177182317 21:17757525-17757547 ACCCCAGTGCCAGATCCACTGGG - Intergenic
1177318791 21:19493962-19493984 GCGCCGGTGCGGGATCCACTAGG + Intergenic
1177497006 21:21902847-21902869 GCCCCCGTGTGGGATCCACTAGG + Intergenic
1177549175 21:22598217-22598239 GCCCCAGCGCAGGATCCACTAGG + Intergenic
1177565756 21:22818796-22818818 GCCCCGGTGTGGGATCCACTGGG - Intergenic
1177637692 21:23807438-23807460 GCCCCAGTGTGGGATCCACTGGG + Intergenic
1177795967 21:25778737-25778759 CAGCCGGTGCGGGATCCACTGGG + Intergenic
1178054603 21:28784180-28784202 GCCCCGGTGTAGGATCCACTAGG + Intergenic
1178082164 21:29077133-29077155 GCCCTAGTGCGTGATCCACTGGG - Intergenic
1178327067 21:31654608-31654630 GCCCAGGTGCGGGATCCACTGGG + Intergenic
1178398818 21:32265754-32265776 GCCCCGGTGCGGGATCCACTAGG + Intergenic
1178585573 21:33868255-33868277 GCCCCGGTGTGGGATCCACTGGG - Intronic
1178983280 21:37283123-37283145 GCCCCGGTGTGGGATCCACTGGG - Intergenic
1179437837 21:41374392-41374414 GCCTCTGTGGAGGCTCCACTCGG - Intronic
1179993255 21:44959524-44959546 GCCCCTGTGCTTGGTCCACGCGG - Intronic
1180740967 22:18053307-18053329 GCCCCTGTGCGGGATCCACTGGG - Intergenic
1180755164 22:18155910-18155932 GCCCAGGTGTGGGATCCACTGGG + Intronic
1181077599 22:20392348-20392370 GCCCCGGTGCGGGATCCACTGGG - Intergenic
1181450468 22:23016990-23017012 GCCCCGGCGCGGGATCCACTGGG - Intergenic
1181486141 22:23232851-23232873 GCCCCTGTTCTGGATCCATTTGG + Intronic
1181800819 22:25346865-25346887 GCCCTGGTGTGGGATCCACGAGG - Intergenic
1182337964 22:29598003-29598025 GCCACGGTGCAGAATCCACTGGG - Intergenic
1183422045 22:37717778-37717800 GCCCCAGAACGAGATCCACTGGG - Intronic
1183685311 22:39358022-39358044 GCCCCGGTGCGGGATCCACTAGG + Intronic
1184857053 22:47152022-47152044 GCCCGTGTGAGGGTTCCTCTGGG + Intronic
1203244033 22_KI270733v1_random:47871-47893 GCCCTGGTGCGGGATCCACTGGG - Intergenic
949259055 3:2084050-2084072 GCCCCGGTGCGGGATCCACTGGG + Intergenic
949292831 3:2485335-2485357 GCCCCAGTGCAGGATCCACTAGG + Intronic
950068884 3:10136374-10136396 GCCCCGGTGCAGGATCCACTGGG - Intergenic
950204775 3:11071157-11071179 GCCCTTACGTGGGATCCACTAGG - Intergenic
950256584 3:11511534-11511556 GCCCCAGTGCAGGATCCACTAGG - Intronic
950256889 3:11513183-11513205 GCCCCGGTGCGGGATCCACTGGG - Intronic
950400893 3:12768730-12768752 CCCCCGGTGCGGGATCCACTGGG - Intronic
950418625 3:12883272-12883294 GCCCCGGTGCGGGATCCACTGGG + Intergenic
950513294 3:13447134-13447156 GCCCCAGTGCGGGATCCACTAGG - Intergenic
950600310 3:14029433-14029455 GCCCCGGTGCAGGATCCACTAGG - Intronic
950601307 3:14037628-14037650 GCCCCGGCACGGGATCCACTAGG + Intronic
950632713 3:14293594-14293616 GCCCCCGTGCGGGATCCACTGGG + Intergenic
951024778 3:17817610-17817632 GCCCCTGTGCAGGATCCACTGGG - Intronic
951332882 3:21387189-21387211 GCCCCGGTGTGGCATCCACTGGG - Intergenic
951491157 3:23271968-23271990 GCCCTGGCGCGGGATCCACTAGG - Intronic
951551800 3:23882469-23882491 GCCCCGGCACAGGATCCACTAGG - Intronic
951734856 3:25852132-25852154 GCCCCGGTGTGAGATCCACTGGG + Intergenic
952058014 3:29473442-29473464 GCCTCCGTGCGGGATCCACTGGG - Intronic
952275325 3:31870538-31870560 GCCCCGGTGCGGGATCCACTGGG + Intronic
952355454 3:32579137-32579159 GCCCCAGTGGGGGATCCACTGGG + Intergenic
952360548 3:32626057-32626079 GCCCCTGTGAGGGATCCACTGGG + Intergenic
952393787 3:32903234-32903256 AACCCCCTGCGGGATCCACTGGG + Intergenic
952398305 3:32940105-32940127 GCCCCAGTGCGGGATCCACTGGG + Intergenic
952593717 3:34988800-34988822 GCCCCAGTGGGGGATCCACTGGG + Intergenic
952713388 3:36453725-36453747 GCCCCGGTGCGGGATCCACTGGG + Intronic
952730724 3:36634330-36634352 GCCCCGGTGCGGGATCCACTGGG + Intergenic
952795325 3:37233441-37233463 GCCCCAGTGCGGGACCCACTGGG + Intergenic
953002965 3:38951574-38951596 GCCCCGGTGCGGGATCCACTGGG + Intergenic
953089905 3:39713738-39713760 GCCCCGGTGCGGGATCCACTAGG + Intergenic
953124428 3:40077846-40077868 GCCCCGGTGCGGGATCCACTGGG - Intronic
953307528 3:41844106-41844128 GCCCCGGTGGGGGATCCACTGGG - Intronic
953423098 3:42770087-42770109 GCCCTGGTGCAGGATCCACTGGG + Intronic
953522421 3:43656364-43656386 GCCCCTGTGCGGGATCCACTGGG - Intronic
953714694 3:45307110-45307132 GCCCCAGTGTGGGATCCACTGGG + Intergenic
954041074 3:47887631-47887653 GCCCCAGTGCGAGATCCACTAGG + Intronic
954089256 3:48271878-48271900 GCCCCAGTGCGGGATCCACTAGG - Intronic
954226129 3:49182602-49182624 GCCCCAGTGCGGGATCCACTGGG - Intronic
954230511 3:49213475-49213497 GCCCCAGTGCAGGATCCACTAGG - Intronic
954620213 3:51990995-51991017 GCCCCGGTGCGGGATCCACTGGG + Intergenic
955183431 3:56692303-56692325 GCCCCAGTGCGGGATCCACTGGG + Intergenic
955210360 3:56934888-56934910 GCCCCGCTGCGGGATCCACTAGG + Intronic
955266385 3:57449283-57449305 GCCCGGGTGTGGGATCCACTAGG - Intronic
955449553 3:59051280-59051302 GCCCCAGTGCGGGATCCACTAGG + Intergenic
956183864 3:66544582-66544604 GCCCTGGTGCGTGATCCACTAGG - Intergenic
956195815 3:66651950-66651972 GCCCCGGTGCAGGATCCACTGGG + Intergenic
956392127 3:68785250-68785272 GCCCCAGTGCGAGATCCACTGGG - Intronic
956438895 3:69260675-69260697 GCCCCAGCACGGGATCCACTAGG + Intronic
956459302 3:69454851-69454873 GCCCCTGCGTGGGATCCACTAGG + Intronic
956481528 3:69677868-69677890 GCCCCGGTGCGGGATCCACTAGG + Intergenic
956563702 3:70612236-70612258 GCCCTGGTGCAAGATCCACTGGG + Intergenic
956632674 3:71331520-71331542 GCCCCGGTGCGGGATCCACTGGG + Intronic
956855335 3:73269615-73269637 GCCCCGGTGCGGGATCCACTAGG + Intergenic
957009109 3:74985063-74985085 GCCCCGGTGTGGGATCCACTGGG - Intergenic
957056095 3:75444372-75444394 GCCCCCGTGTGGGATCCACTTGG - Intergenic
957074155 3:75588177-75588199 GCTCCTGTGTGGGATCCACTGGG + Intergenic
957277544 3:78108811-78108833 GCCCCCGAGCGGGATCCACTGGG + Intergenic
957362159 3:79173745-79173767 GCCCCAGTGCGGGATCCACTGGG + Intronic
957419586 3:79951308-79951330 GCCCCCATGCGGGATCCACTGGG - Intergenic
957446193 3:80314871-80314893 GCCCCAGTGTGGGATCCACTGGG + Intergenic
957556221 3:81767314-81767336 GCCCCAGTGCGGGATCCACTGGG - Intergenic
957560089 3:81811946-81811968 GCCCCGGTGCGGGATCCACTGGG - Intergenic
957631015 3:82715753-82715775 GCCCCCATGCGGGATCCACGGGG + Intergenic
957804827 3:85133798-85133820 GCCCCGGTGAGGGATCCACTGGG - Intronic
957829935 3:85504613-85504635 GCCCCGGTGAGGTATCTACTGGG - Intronic
957885566 3:86282648-86282670 GCCCCACTGCCGGATCCACTGGG + Intergenic
957919604 3:86731448-86731470 GCCCTGGTGCGGGATCCACTGGG - Intergenic
957921898 3:86758022-86758044 GCCCCAGTGCGGGATCCACTGGG + Intergenic
957995181 3:87679521-87679543 GCCCGCGTGTGGGATCCACTAGG + Intergenic
958022716 3:88016111-88016133 GCCCCGGTGGGGGATCCACTGGG + Intergenic
958419947 3:93918007-93918029 GCCCCAGTGCAGGATCCACTGGG + Intronic
958548516 3:95588475-95588497 GCCCTGGAGCAGGATCCACTAGG - Intergenic
958810688 3:98857910-98857932 GCCCCGGTGCGGGATCCACTGGG - Intronic
959422811 3:106149056-106149078 GCCCCTGTGCGAGATCCACTGGG + Intergenic
960149723 3:114238227-114238249 GCCCCGGTGCGGGATCCACTGGG - Intergenic
960199333 3:114812634-114812656 GCCCGGGTGCGGGATCCACTGGG - Intronic
960227458 3:115184826-115184848 AGCCCGGTGCGGGATCCACTGGG - Intergenic
960479607 3:118171772-118171794 GCCCCAGCAAGGGATCCACTAGG + Intergenic
960559962 3:119073336-119073358 GCCCTGGCGCGGGATCCACTAGG - Intronic
960669279 3:120140671-120140693 GCCCCCGTGCAGGATCTACTAGG + Intergenic
960685562 3:120290092-120290114 GCCCCAGTGTGGGATCCACTGGG + Intergenic
960761591 3:121078469-121078491 GCCCTGGTGCAGGATCCACTGGG - Intronic
960868513 3:122227152-122227174 GTCCCGGTGCGGGATCCACTGGG - Intronic
961268877 3:125672164-125672186 GCCGCTGTGGGGGATCCACTAGG + Intergenic
961279937 3:125758563-125758585 GCTCCTGTGCGGGATCCACTGGG - Intergenic
961298294 3:125904315-125904337 GCCCCAGTGCGGGATCCACCTGG + Intergenic
961460537 3:127047100-127047122 GCCCCGGTGCGGGATCCACTAGG + Intergenic
961461928 3:127056208-127056230 GCCCCTGTGCGGGATCCACTGGG - Intergenic
961464978 3:127076222-127076244 GCCCCGGTGTGGGATCCACTGGG - Intergenic
961688887 3:128653821-128653843 GCCCGGGTGCAGGATTCACTGGG + Intronic
961746645 3:129068245-129068267 GCCCCCGTGCGGGATCCACTGGG - Intergenic
961874458 3:130011016-130011038 GCTCCTGTGTGGGATCCACTGGG + Intergenic
961932248 3:130547002-130547024 GCCCCCATGCAGGATCCACTAGG - Intergenic
961956961 3:130814779-130814801 GCCCTGGTGCGGGATCCACTGGG - Intergenic
962177166 3:133167337-133167359 GCCCTGGAGCAGGATCCACTAGG - Intronic
962283675 3:134070198-134070220 GCCCCGGTGTGGGATCCACTAGG - Intronic
962383689 3:134916293-134916315 GCCCTCGTGTGGGATCCACTGGG - Intronic
962398679 3:135039364-135039386 GCCCCAGTGCGGGATCCACTAGG - Intronic
962590997 3:136889938-136889960 ACCCCTGTGCGGGATCCACTGGG - Intronic
962600423 3:136987525-136987547 GCCCTGGTGCGGGATCCACTGGG - Intronic
962758328 3:138485072-138485094 GCCCTGGTGTGGGACCCACTGGG + Intergenic
962998208 3:140651814-140651836 GCCCTGGTGTGGGATCCACTGGG + Intergenic
963397291 3:144750231-144750253 GCCCTGGTGCGGGATCCACTGGG + Intergenic
963440485 3:145333800-145333822 GCCCCGGTGCGGGATCCACTGGG + Intergenic
963509081 3:146225369-146225391 GCCCTGCTGCGGGATCCACTAGG - Intronic
963554733 3:146772761-146772783 GGTCCGGTGCTGGATCCACTAGG + Intergenic
963589916 3:147245542-147245564 GCCCCGGTGCAGGATCCACTGGG - Intergenic
963651752 3:147989314-147989336 GTCCTGGTGCGGGATCCACTGGG - Intergenic
963673435 3:148280503-148280525 GCCCCAGTGCGGGATCCACTGGG - Intergenic
963742846 3:149097658-149097680 GCCCAGGTGCAGGATCCACTGGG - Intergenic
963744230 3:149109779-149109801 GCCCGGGTGCAGGATCCACTGGG + Intergenic
963760667 3:149284409-149284431 GCCCTGGTGCGGGATCCACCGGG + Intergenic
963862254 3:150323393-150323415 ACCCCGGTGCTGGATCCACTGGG + Intergenic
964014461 3:151928579-151928601 GCTCCGGTGCGGGATCCACTGGG + Intergenic
964032401 3:152152842-152152864 GCCCCGGTAAGGGATCCACTGGG + Intergenic
964037611 3:152217724-152217746 GCCCTGGTGCGTGATCCACTGGG + Intergenic
964117898 3:153155686-153155708 GCCCCATTGCGCGATCCACTGGG - Intergenic
964138277 3:153369689-153369711 GCCCCAGCACGGGATCCACTAGG - Intergenic
964139149 3:153378273-153378295 GCCCCAGTGCGGGATCCACTAGG - Intergenic
964198214 3:154088394-154088416 GCCCCGGTGTGAGATCCACTGGG + Intergenic
964265305 3:154889187-154889209 GCCCTGGTGCAGGATCCACTAGG - Intergenic
964393709 3:156223849-156223871 GCCCCAGTGCGGGATACACTGGG - Intronic
964444078 3:156741000-156741022 TCCCCTGTGCGGGATCCACTGGG + Intergenic
964452074 3:156822614-156822636 GCCCCAGTGCGAGACCCACTGGG - Intergenic
964751935 3:160060951-160060973 GCCCCTGTGCAGGGTCCACTGGG + Intergenic
964802817 3:160573926-160573948 GCCAGGGTGCGGGATCCACTGGG - Intergenic
964974250 3:162600126-162600148 ACCCCAGTGCGAGATCCACTGGG + Intergenic
964977832 3:162640494-162640516 GCCCAGGTACGGGATCAACTGGG + Intergenic
964982429 3:162702858-162702880 GGACAGGTGCGGGATCCACTGGG - Intergenic
964983079 3:162710445-162710467 GCCCTGGCGCGGGATCCACTGGG - Intergenic
964993438 3:162844553-162844575 GCCCCAGTGCAGGATCCACTAGG - Intergenic
965003597 3:162987742-162987764 GGCCAGGTGCAGGATCCACTGGG + Intergenic
965040373 3:163499447-163499469 GCCCCAGTGTGAGATCCACTGGG + Intergenic
965044061 3:163552260-163552282 ACCCCTGTGCGGGATCCACTGGG - Intergenic
965078072 3:164003391-164003413 GCCCCAGTGCGGGATCCACTGGG + Intergenic
965109343 3:164401826-164401848 GCCCCGGTGCGGGATCCACTGGG - Intergenic
965200270 3:165649254-165649276 GCCGCAGTGCGGGATCCACTGGG - Intergenic
965220136 3:165918383-165918405 GCACCGGTGCAGGATCCACTGGG - Intergenic
965220822 3:165924274-165924296 GCCCAGGTGCGGGATCCACTGGG - Intergenic
965245165 3:166258405-166258427 GCCCTGGTGTGGGATCCACTGGG - Intergenic
965256855 3:166424355-166424377 AGCCTGGTGCGGGATCCACTGGG + Intergenic
965288120 3:166843234-166843256 GCCCTGGTGTGGGATCCACTGGG + Intergenic
965298203 3:166976256-166976278 GCCCCGGTGCGGGATCCACTGGG + Intergenic
965372771 3:167884988-167885010 TCCCCTGTGCTGTATCCTCTTGG + Intergenic
965446540 3:168780531-168780553 GCCCTGGTGCTGGATCCACTGGG + Intergenic
965652443 3:170947646-170947668 GCCCTGGTGCGGGATCTACTAGG + Intergenic
965753155 3:171998808-171998830 GCCCCAGTGTGGGATCCGCTAGG - Intergenic
965943405 3:174211909-174211931 GCCCCAGTGCGGGATCTACTGGG - Intronic
966076134 3:175937795-175937817 GCCCCAGTGCACGATCCACTGGG + Intergenic
966096709 3:176213353-176213375 GCCCCAGTGCGGGATCCACTGGG - Intergenic
966182960 3:177203812-177203834 GCCCCAGCACTGGATCCACTAGG - Intergenic
966186097 3:177228596-177228618 GCCCCAGCACAGGATCCACTAGG - Intergenic
966190937 3:177271665-177271687 GCCCCGGTGCAGGATCCACTGGG - Intergenic
966246002 3:177808887-177808909 GCCCCGGTGCAAGATCCACTGGG - Intergenic
966372354 3:179262991-179263013 GCCCCGGTGCGGGATCCACTGGG - Intronic
966548901 3:181182956-181182978 GCCCCTGTGAGGGATCCACTGGG - Intergenic
966725078 3:183101323-183101345 GCCCCGGTGCGGGATCCACTAGG + Intronic
966725354 3:183103684-183103706 GCCCCAGTGCCGGACCCACTGGG - Intronic
967234026 3:187367513-187367535 CCCCCGGGGCGGGATCCACTGGG - Intergenic
967448578 3:189596547-189596569 GCCCCGGTGGGAGATCCACTGGG + Intergenic
967499076 3:190176986-190177008 GCCCCGGTGCAGGATCCACTGGG - Intergenic
967594841 3:191316950-191316972 GCCCCGGCGTGGGATCCGCTAGG - Intronic
967718435 3:192789455-192789477 GGCCTGGTGCGGTATCCACTGGG + Intergenic
968181517 3:196598975-196598997 GCCCCAGTGCGGGATCCACTGGG - Intergenic
968412736 4:403937-403959 GCCCCGGCGCGGGATCCACTGGG - Intergenic
968469745 4:773951-773973 GCCCCAGCGCAGGATCCACTGGG + Intergenic
968532417 4:1099841-1099863 ACCCCTGTGCGGGATCCACGGGG + Intronic
968716235 4:2161691-2161713 GCCCCTGTGCGAGATCCGCTGGG + Intronic
968998903 4:3964653-3964675 GCCCCCGTGAGGGATCCACTTGG - Intergenic
969017774 4:4115777-4115799 GCTCCTGTGTGGGATCCACTGGG + Intergenic
969303074 4:6308971-6308993 GCCCGGTTGGGGGATCCACTAGG - Intergenic
969362430 4:6673146-6673168 GCCCTGGTGTGGGATCCACTTGG + Intergenic
969440816 4:7215552-7215574 GCCCCGGTGCGGGATCCACTGGG + Intronic
969654903 4:8491347-8491369 GCCCTGGTGCGGGATCCACTAGG - Intronic
969736218 4:8992835-8992857 GTTCCTGTGTGGGATCCACTGGG - Intergenic
969755092 4:9143980-9144002 GCCCCCGTGTGGGATCTACTTGG + Intergenic
969814999 4:9680263-9680285 GCCCCCATGTGGGATCCACTTGG + Intergenic
970051315 4:11918057-11918079 GTCCCAGTGCAGGATCCACTGGG + Intergenic
970182664 4:13415806-13415828 GCCCCAGTGCAGGATCCACTGGG + Intronic
970272185 4:14359036-14359058 GCCCCATTGCAGGATCCACTGGG + Intergenic
970391291 4:15615337-15615359 ACCCCGGTGTGGGATCCACTGGG + Intronic
970574502 4:17414242-17414264 GCCCCTGTGCGGGATCCACTAGG - Intergenic
970615682 4:17766746-17766768 GCCCCGGTGCGGGATCCTCTAGG - Intronic
970649247 4:18159207-18159229 GCCCCGGTGCGGGATCCACTGGG - Intergenic
970673088 4:18418274-18418296 GCCCCGGTGCGGGATCCACTGGG - Intergenic
970691911 4:18630503-18630525 GCCCTGGTGCGGGATCCACTAGG - Intergenic
970803608 4:20004438-20004460 GCCCCGGTGCGGGATCCACTGGG + Intergenic
970817808 4:20178948-20178970 GCCCTAGTACGGGATCCACTGGG - Intergenic
971280456 4:25239179-25239201 GCCCCAGTGTGGGATCCACTGGG - Intronic
971281606 4:25246561-25246583 GCCCCAGTGTGGGATCCACTGGG - Intronic
971377034 4:26063907-26063929 GCCCCAGTGCGGGATCCACTGGG - Intergenic
971552965 4:27978272-27978294 GCCCCAGTGTGGGATCCACTAGG - Intergenic
971563635 4:28113199-28113221 GCCCAGGTGTGGGATCCACTGGG + Intergenic
971564118 4:28117081-28117103 GTCCGGGTGCGGGATCCACTAGG - Intergenic
971618853 4:28828430-28828452 GCCCCAGTGCAGGATCCACTAGG + Intergenic
971639898 4:29117777-29117799 GCCCCAGTGCGGGATCCACTGGG + Intergenic
971709535 4:30093130-30093152 GCCCCAGAGCGGGATCCACTGGG + Intergenic
971792275 4:31184906-31184928 GCCCCGGAGCGGGATCCACTAGG - Intergenic
971905115 4:32716162-32716184 GCCCCGGTGCAGGAGCCACTGGG - Intergenic
972022711 4:34335577-34335599 GCCCTGGTGTGGGATTCACTGGG - Intergenic
972034725 4:34506557-34506579 GCCCCCGTGCCGGATCCACTGGG - Intergenic
972173454 4:36375394-36375416 GCCCCAGTGTGGGATCCACTAGG + Intergenic
972360870 4:38324856-38324878 GCCCTGGTGCAGGATCCACTAGG - Intergenic
972392633 4:38627326-38627348 GGGGCAGTGCGGGATCCACTGGG + Intergenic
972505713 4:39718451-39718473 GCCCCGGTGCGAGATCCACTGGG - Intronic
972900201 4:43672781-43672803 GCCCTGGTGCGGGATCCACTAGG + Intergenic
972913387 4:43846599-43846621 GCCCCAGCACGGGATCCACTAGG + Intergenic
973037179 4:45420574-45420596 GCACCTGTGCGGGATCCACTGGG + Intergenic
973039866 4:45457054-45457076 GCCCCGGTGCAGGATCCACTAGG - Intergenic
973041730 4:45477288-45477310 GCCCCGGTGCAGGATCCACTGGG - Intergenic
973045462 4:45530876-45530898 GCCCTGGTGCGGGATCCACTAGG + Intergenic
973048654 4:45567476-45567498 GCCCAAGTGCAGGATCCACTGGG + Intergenic
973135328 4:46699276-46699298 GCCCTGGTGCGAGATCCACTAGG + Intergenic
973142159 4:46782081-46782103 GCCCCTGCGCAGGATCCACTAGG + Intronic
973144191 4:46804767-46804789 GCCCCGGTAGGGGATACACTGGG - Intronic
973146400 4:46831471-46831493 GCCCCAGTGCGGGATCCACTGGG + Intronic
973214554 4:47654817-47654839 GCCACTCTGCGGCATGCACTAGG - Intronic
973308150 4:48675764-48675786 GCCCCTGTGCAGGATCCACTAGG + Intronic
973322837 4:48827805-48827827 GCCCCGGCATGGGATCCACTAGG + Intronic
973587685 4:52409682-52409704 GCCCTGGTGCGGGATCCACTGGG - Intergenic
973684272 4:53354020-53354042 GCCCTGGCGCGTGATCCACTAGG - Intronic
973765019 4:54155062-54155084 GGCCTGGTGCAGGATCCACTGGG - Intronic
973817661 4:54632959-54632981 GCCCCAGTGCGGGATCCACTGGG + Intergenic
973854180 4:54993893-54993915 GCCCCGGTGCAGGATCCACTGGG + Intergenic
974089816 4:57300108-57300130 GCCCTGGTGCAGGATCCACTAGG - Intergenic
974128886 4:57729709-57729731 GCCCAGGTGTGGGATCCACTGGG - Intergenic
974147495 4:57965848-57965870 GCCCCAGTGCGGGATCCACTGGG + Intergenic
974147783 4:57967614-57967636 GCCCTGGTGCGGGATCCACTAGG + Intergenic
974186864 4:58457352-58457374 GCCCCAGTGGGGGATCCACTAGG + Intergenic
974299170 4:60042159-60042181 GCCCTGGTGCGGGATCCACTAGG - Intergenic
974484709 4:62491834-62491856 GCCCAGGTGCAGGATCCACTGGG - Intergenic
974590512 4:63942819-63942841 GCCCAGGTGCGGGATCCACTGGG - Intergenic
974641671 4:64640410-64640432 GCCCCCATGCGGGATCCACTAGG - Intergenic
974781664 4:66561429-66561451 GCCCTGGTGTGGGATCCACTGGG - Intergenic
974792692 4:66712355-66712377 GCCCCAGTGCGGGATCCACTGGG - Intergenic
974804464 4:66860592-66860614 GCCCCGGTGCGGGATCCACTGGG + Intergenic
974807489 4:66899398-66899420 GCCTTGGTGCGGGATCCACTAGG - Intergenic
974827835 4:67152303-67152325 GCCCCTGTGCGGGATCCACTGGG + Intergenic
974839264 4:67282761-67282783 GCCCCAGCATGGGATCCACTAGG - Intergenic
974992797 4:69115177-69115199 ACCCCAGTGTGGGATCCACTGGG - Intronic
975055475 4:69924314-69924336 GCCCCAGTGTGGGATCCACTGGG + Intergenic
975298885 4:72766279-72766301 GACCCCCTGCGGGATCCACTGGG + Intergenic
975308623 4:72877502-72877524 GCCCCAGTATGGGATCCACTGGG + Intergenic
975439871 4:74399002-74399024 GGCCCGGTGGGGGATCCACTGGG - Intergenic
975745015 4:77466766-77466788 GGCCCCGGGCAGGATCCACTGGG + Intergenic
975755942 4:77571086-77571108 GCCCCGGTGTGGGATCCACTGGG + Intronic
975995002 4:80303217-80303239 GCCCCAGTGCGGGAGCCACTGGG + Intronic
976102565 4:81580874-81580896 GCCCCGGTGTGGGATCCACTAGG + Intronic
976406456 4:84665122-84665144 GCCCCCGTGCAGGATCCACTGGG + Intergenic
976520556 4:86021544-86021566 GCCCTGGTACGGGATCCACTAGG - Intronic
976646796 4:87395883-87395905 GCCCCTGTGCGGGATCCACTAGG - Intergenic
976736229 4:88313140-88313162 GCCCCAGTGCGGGATCCACTGGG - Intergenic
976846134 4:89490428-89490450 GCCTCCGTGCGGGATCCACCTGG + Intergenic
976933912 4:90604591-90604613 GCCCGCTTCCGGGATCCACTAGG + Intronic
976980221 4:91217907-91217929 GCCCCGGTGCGGGATCCACTAGG - Intronic
977206601 4:94170267-94170289 GCCCCAGTAGGGGATCCACTAGG + Intergenic
977369643 4:96119657-96119679 GCCCCTGTGCCGGAACCACAAGG - Intergenic
977400151 4:96521548-96521570 GCGCCAGCACGGGATCCACTAGG + Intergenic
977416731 4:96742942-96742964 GCTCCAGTGCGGGATCCACTAGG + Intergenic
977470623 4:97438019-97438041 GCCCCGGTGCGGGATCCACTGGG - Intronic
977606843 4:98993418-98993440 GCCCCAGTGCGGGAACCACTGGG - Intergenic
977717273 4:100196457-100196479 GCCCTGGTTCGGGATCCACTGGG - Intergenic
977750888 4:100608702-100608724 GCCCCGGTGCGGGATCCACTAGG - Intronic
977883671 4:102234762-102234784 GCCCCTGCATGGGATCCACTAGG + Intergenic
977885693 4:102250234-102250256 GCCCCGGTGCAGGATCCACTGGG - Intergenic
977906552 4:102483552-102483574 GCCCCAGTGCAGGATGCACTAGG + Intergenic
978030675 4:103937218-103937240 GCCCGGGTGCAGGATCCACTAGG + Intergenic
978080327 4:104582404-104582426 GCCCCGGTGCGGGATTCACTGGG + Intergenic
978207120 4:106092336-106092358 GCCCCAGTGTGGGATCCACTGGG - Intronic
978241809 4:106525281-106525303 GCCCCAGTGAGGGATCCACTGGG - Intergenic
978254804 4:106681385-106681407 GCCCTGGTGTGAGATCCACTGGG - Intergenic
978463547 4:108984328-108984350 GCCCCTGTGCGGGATCCACTGGG - Intronic
978809168 4:112831229-112831251 GCCCTGGTGCAGGATCCACTAGG + Intronic
978917904 4:114148517-114148539 GCCCCAGTGCAGGATCCACTGGG - Intergenic
978997968 4:115179368-115179390 GCCCCAGTGTGAGATTCACTGGG - Intergenic
978999503 4:115200131-115200153 GCCCCAGTGCGGGATCCACTGGG - Intergenic
979290742 4:118976987-118977009 GCCCCGGTGCGGGATCCTCTAGG - Intronic
979308397 4:119174209-119174231 GCCCTGGTGCGGGATCCTCTAGG + Intronic
979424678 4:120550674-120550696 ACCCCAGTGCGGGATCCACTAGG - Intergenic
979445610 4:120808548-120808570 ACCCCAGTGTAGGATCCACTGGG - Intronic
979609094 4:122670638-122670660 GCCCCAGTGCCGGATCCACTGGG + Intergenic
979688670 4:123538340-123538362 GCCCAGGTGCGGGATCCACTGGG + Intergenic
979755942 4:124339435-124339457 GCCCTGGTGCGGGATCCACTGGG + Intergenic
979822623 4:125192325-125192347 GCCCCTGTGAGGGATCCACTAGG + Intergenic
979825629 4:125229519-125229541 GCCCCAGTGCGGGATCCACTGGG - Intergenic
979857437 4:125651700-125651722 CCCCCGGTGTGGGATCCACTGGG - Intergenic
979899629 4:126201228-126201250 GCCCCGGTGCGGGATCCACTGGG - Intergenic
979949444 4:126874392-126874414 GCCCTGGTGCAGGATCCACTAGG - Intergenic
979991540 4:127380364-127380386 GCCCTGGTGCGGGATCCACTAGG + Intergenic
980043302 4:127964174-127964196 GCCCCGGTGCGGGATCCACTGGG - Intronic
980051854 4:128047496-128047518 GCCCCGCTGCGGGATCCACTGGG - Intergenic
980115282 4:128673042-128673064 GCCTCTGTGCGGGATCCACTGGG + Intergenic
980228056 4:130013203-130013225 GCCCCGCTGCCGGATCCACTAGG + Intergenic
980230181 4:130038483-130038505 GCCCCACTGCCGGATCCACTGGG - Intergenic
980470152 4:133240344-133240366 GCCCCGGTGTGGGATCCACTAGG - Intergenic
980563087 4:134502218-134502240 GCCCTGGCGCAGGATCCACTAGG + Intergenic
980595359 4:134948088-134948110 GCCCTGGTGCAGGATCCACTAGG - Intergenic
980628669 4:135407042-135407064 GCCCCGGTGCGGGATCTACTGGG + Intergenic
980739335 4:136929418-136929440 GCCCCGGTGTGGGATCCACTGGG + Intergenic
980774572 4:137421443-137421465 TGCCCACTGCGGGATCCACTGGG + Intergenic
980799837 4:137734159-137734181 GCCCCAGTGCGGGATCCACTAGG + Intergenic
980815633 4:137942494-137942516 GCCCCGGTGCGGGATCCACTGGG + Intergenic
980824038 4:138052883-138052905 AGCCCCCTGCGGGATCCACTGGG - Intergenic
981136274 4:141213970-141213992 GCCCCAGCGTGGGATCCACTAGG + Intergenic
981146647 4:141332955-141332977 GCCCCGCTGCGGGATCCACTGGG - Intergenic
981169489 4:141605370-141605392 GCCCAGGTGTGGGATCCACTGGG - Intergenic
981176514 4:141689795-141689817 GCCCCAGTGTGGGATCCACTGGG - Intronic
981275891 4:142897921-142897943 ACCCCGGTGTGGGATTCACTGGG + Intergenic
981280676 4:142954684-142954706 GCCCCAGCGCAGGATCCACTAGG + Intergenic
982408302 4:155044726-155044748 GCCCTGGTGTGGGATCCACTAGG + Intergenic
982647739 4:158044550-158044572 GCCCGGGTGCGGGATCCCCTGGG + Intergenic
982770238 4:159390379-159390401 GCCCAGGCACGGGATCCACTAGG + Intergenic
982814504 4:159868969-159868991 GCCCCGGTGCGGGATCCACTGGG - Intergenic
982863467 4:160482191-160482213 GCCCCGGTGCAGGATCCACTGGG + Intergenic
982868726 4:160550045-160550067 GCCCCGGTGCAGGATCCACTGGG - Intergenic
982921347 4:161277650-161277672 AGCCCGGTGCGGGATCCACTGGG + Intergenic
983026172 4:162739964-162739986 GCCCTGGTGTGGGATCCACTGGG + Intergenic
983060414 4:163153274-163153296 GGTGCAGTGCGGGATCCACTGGG + Intronic
983064012 4:163189651-163189673 GCCCGGGTGCGAGATCCATTGGG - Intergenic
983135014 4:164068777-164068799 GCCCTGGTGAGGGATCCACTGGG + Intronic
983230586 4:165125877-165125899 GCCGCCGTGCGGGATCCACTGGG - Intronic
983290597 4:165799334-165799356 GCCCTGGTGCAGGATCCACCAGG - Intergenic
983552982 4:169035773-169035795 GCCCGGATGTGGGATCCACTAGG - Intergenic
983656816 4:170091654-170091676 GCCCCAGTGCCGGCTCCACTGGG + Intronic
983752922 4:171298704-171298726 ACCCCGGTGCGGGATCCACTGGG + Intergenic
983834163 4:172369418-172369440 GCCCTGGCACGGGATCCACTAGG - Intronic
984069364 4:175092537-175092559 GCCCAGGTGCGGGATCCATTAGG + Intergenic
984238741 4:177193133-177193155 GCCCAGGTGCGGGATCCACCGGG - Intergenic
984241766 4:177227502-177227524 GCCCCGGTGCAGGATCCACTGGG - Intergenic
984265739 4:177496015-177496037 GCCCCTGTGCGGGATCCACTGGG + Intergenic
984275661 4:177607045-177607067 GCCCTGGTGCGGGACCCAGTGGG - Intergenic
984662325 4:182386973-182386995 GCCCCTGTGCGGGATCCACTGGG + Intronic
984728725 4:183045489-183045511 GCCCCAGTGCAGGATCCACTAGG + Intergenic
984770641 4:183433568-183433590 GCCCCGGTGCAGGATCCACTGGG + Intergenic
984776031 4:183482625-183482647 GCCCCGGTGGGGGATCCACTGGG - Intergenic
984901823 4:184592290-184592312 GCCCTGGTGCGGGATCCACTGGG + Intergenic
984918181 4:184741627-184741649 GCCCTGGTGTGGGATCCACTAGG + Intergenic
984948643 4:184990024-184990046 GCCCTGGTGCAGGATCCACTAGG - Intergenic
985195039 4:187420559-187420581 GCCCCAGTGTGGGATCCACTAGG - Intergenic
985203327 4:187506054-187506076 GCCCCTGTGCGGGATCCACTGGG + Intergenic
985366477 4:189236729-189236751 GTCCTTGTGCGGGATCCACTGGG + Intergenic
985403792 4:189616583-189616605 GCCCCTGTGCGGGATCCACTGGG - Intergenic
985409100 4:189664677-189664699 GGCCAGGTGCGGGATCCACTAGG - Intergenic
985412032 4:189695626-189695648 GCCCTGGTGCAGGATCCACTGGG - Intergenic
985590960 5:764780-764802 CCCCCGGTGTGGGAGCCACTAGG + Intronic
985755028 5:1708745-1708767 GCCCCTGGGCGGGCTCCAAGTGG - Intergenic
986121219 5:4837957-4837979 GCCCCGGTGTGGGATCCACTGGG + Intergenic
986625723 5:9722196-9722218 TCCCCTGTGGGGGGTCCTCTTGG - Intergenic
986626253 5:9725751-9725773 GCTCCAGTGCGGGATCCACTGGG + Intergenic
986661832 5:10065927-10065949 GCCCGGGTGCGGGATCCAGTGGG + Intergenic
986698072 5:10375580-10375602 GCCCGGGTGCGGGATCCACTAGG + Intronic
986707082 5:10461204-10461226 GCACCTGTGCGAGATCCTCACGG + Exonic
986747082 5:10754292-10754314 GCTCCTGTAAGGGCTCCACTTGG - Intronic
986963663 5:13244609-13244631 GCCCCAGCGTGGGATCCACTAGG + Intergenic
986993348 5:13578893-13578915 AGCCCGGTGCCGGATCCACTGGG + Intergenic
987084404 5:14455831-14455853 GCCCTGGTGCAGGATCCACTAGG - Intronic
987146174 5:14993741-14993763 GCCCCGGTGTGGGATCCACTGGG - Intergenic
987156685 5:15096452-15096474 GCCCTGGTGCGGGATCCACTGGG - Intergenic
987283809 5:16436604-16436626 GCCCTGGTGCGGGATCCACTGGG + Intergenic
987315367 5:16718375-16718397 GCCCTGGTGCGGGATCCACTAGG + Intronic
987347366 5:16990918-16990940 GCCCCAGTGCGGGATCCACTGGG - Intergenic
987352224 5:17032412-17032434 GCCCCGGTGCAGGATCCACTGGG - Intergenic
987383934 5:17311710-17311732 GCCCCGGTGCAGGATCCACTGGG - Intergenic
987476609 5:18399598-18399620 AGCCCCGTGCGGGATCCACCAGG - Intergenic
987543906 5:19288168-19288190 GCCCTGGTGCGCGATCCACTGGG + Intergenic
987877023 5:23691548-23691570 GCCCCAGTGCGGGATCCACTAGG + Intergenic
987896369 5:23951720-23951742 GCCCCGGTGAGGGATCCACTGGG + Exonic
987990174 5:25199959-25199981 GCCCCTCTGTGGGATCCACTGGG - Intergenic
988073583 5:26324884-26324906 GCCCCGGTGCGGGATCCACTGGG + Intergenic
988086911 5:26485217-26485239 GCCCCCATGCGGGATCCACTGGG - Intergenic
988132236 5:27120323-27120345 GCCCCGGTGTGGGATCCACTAGG + Intronic
988154979 5:27439387-27439409 GCCCCGGTGCAGGATCCACTAGG - Intergenic
988177347 5:27743884-27743906 GCCCTGGTGTGGGATCCACTGGG + Intergenic
988201701 5:28077605-28077627 GCCACCGTGTGGGATCCACTGGG - Intergenic
988279486 5:29127560-29127582 GCCCCAATGCGGAATCCACTGGG - Intergenic
988291690 5:29296429-29296451 GCCCCAGTGGGGGATCCAATGGG - Intergenic
988369341 5:30346175-30346197 GCCCCTGTGCGGGATCCACTGGG + Intergenic
988489070 5:31691950-31691972 GCCCTGGTGTGGGATCCACTGGG - Intronic
988684661 5:33515325-33515347 GCCCCTGTGTGGGATCCACTGGG - Intergenic
988883671 5:35532051-35532073 GCCCCAGTGCAGGATCCACTGGG + Intergenic
988915823 5:35892804-35892826 ACCCCAGTGCGGGATCCACTAGG - Intergenic
989003279 5:36783004-36783026 GCCCCGGTGTGGGATCCACTGGG + Intergenic
989346870 5:40439083-40439105 GCCCCGGTGCGGGATCCACTAGG + Intergenic
989956925 5:50369861-50369883 GCCCCGGTGTGGGATCCACAGGG + Intergenic
989965896 5:50465437-50465459 GCCCTGGTGCAGGATCCACTAGG + Intergenic
990243314 5:53837351-53837373 GCCCCCCTGCGGGATCCACTGGG + Intergenic
990419041 5:55613774-55613796 GCCCCCGTGCAGGATCCACTAGG + Intergenic
990461597 5:56035913-56035935 GCCCTGGTGCGGGATCCAATAGG + Intergenic
990490141 5:56295748-56295770 GCCCCTGTGAGGGATCCACTGGG + Intergenic
990510896 5:56488088-56488110 GCCCTGGTGCGGGATCCACTAGG + Intergenic
990512067 5:56498597-56498619 GGCCTGGTGCGGGATCCACTGGG - Intergenic
990665642 5:58069076-58069098 GCCCCGGTGTGGGATCCACTAGG - Intergenic
990869546 5:60415838-60415860 CGCCCGGTGCGGGACCCACTGGG + Intronic
990880296 5:60530721-60530743 GCCCCCGTGCGGGATCCACTGGG + Intergenic
991215022 5:64150494-64150516 GCCCTGGTGCGAGATCCACTGGG + Intergenic
991330161 5:65485415-65485437 GCCCCGGTGCGGGATCCACTGGG - Intergenic
991567485 5:68020339-68020361 GCCGCCGTACGGGATCCACTGGG - Intergenic
991657866 5:68921290-68921312 CCCCCGGTGTGGGATCCACTGGG + Intergenic
992048944 5:72925911-72925933 GCCCCGGCGTGGGATCCACTAGG + Intergenic
992050437 5:72935667-72935689 GCCCCAGCGTGGGATCCACTAGG + Intergenic
992296812 5:75334109-75334131 GCCCTGGTGCAGGATCCACTGGG + Intergenic
992802911 5:80309927-80309949 GCCCTGGCACGGGATCCACTAGG - Intergenic
992947524 5:81824137-81824159 GCCCTGGTGCGGGATCCACTGGG + Intergenic
993031950 5:82715113-82715135 GCCCCAGTGCGGGATCCACTGGG + Intergenic
993320858 5:86466618-86466640 GCCCCGGTGTGGGATCCACTAGG - Intergenic
993529111 5:89003561-89003583 ACCCCGGTGCGGGATCCACTGGG - Intergenic
993678530 5:90847454-90847476 GCCCTGGTGCGGGATCCACTGGG - Intronic
993770372 5:91917700-91917722 GCCGTGGTGCGAGATCCACTGGG + Intergenic
993803464 5:92374830-92374852 GCCCCAGTGTGGAATCCACTGGG - Intergenic
993822117 5:92631755-92631777 GCCCCAGTGTGGGATCCACTGGG + Intergenic
994096420 5:95851590-95851612 GCCCAGGTGCGGGATCCACTGGG + Intergenic
994167076 5:96618884-96618906 GCCCCGGCACAGGATCCACTAGG + Intronic
994210696 5:97085151-97085173 GCCCCGGTGCCGGCTACACTAGG - Intergenic
994230039 5:97301572-97301594 GCCCCAGTGCAGGATCCACTGGG + Intergenic
994251435 5:97541813-97541835 GCCCTGGTGCAGGATCCACTGGG - Intergenic
994254718 5:97579931-97579953 GCCCCGGTGCGGGATCCACTGGG - Intergenic
994507192 5:100657186-100657208 GCCCCCCTGCAGGATCCACTGGG + Intergenic
994509764 5:100688804-100688826 GCCCCCGTGCGGGATCCACTGGG - Intergenic
994570375 5:101506452-101506474 GCCCTGGTGCAGGATCCACTAGG + Intergenic
994605530 5:101962382-101962404 GCCCCTGTGCGGGATCCACTAGG - Intergenic
994620427 5:102155364-102155386 GCCCCTGTGGGAGATCCACTGGG + Intergenic
994647687 5:102491328-102491350 GCCCCGGTAGGGGATCCACTGGG - Intronic
994701626 5:103141971-103141993 GCCCTGGTGCGGGATCCACTGGG - Intronic
994768542 5:103953712-103953734 GCCCAGGCGCTGGATCCACTAGG - Intergenic
994769713 5:103966263-103966285 GCCCCAGTGCGAGATCCACTGGG - Intergenic
994841469 5:104929425-104929447 GCCCCGGTGCGGGATCCACTGGG + Intergenic
994928880 5:106154681-106154703 GCCCCTGTGCGGGATCCACTGGG + Intergenic
994932368 5:106206026-106206048 GCCCCAGTGCAGGATCCACTGGG - Intergenic
995032383 5:107494619-107494641 GCCCCGTTGGGGGATCCACTGGG + Intronic
995112307 5:108442018-108442040 GCCCCGGTATGGGATCCACTGGG - Intergenic
995326344 5:110893964-110893986 GCCCCCGTGCGGGATCCACTGGG - Intergenic
995388256 5:111612088-111612110 GCCCTGGTGCGGGATCCAGTGGG - Intergenic
995529213 5:113075459-113075481 GTCCCAGCGCAGGATCCACTAGG + Intronic
995568746 5:113457567-113457589 GCCCAGGTGCAGGATCCACTGGG + Intronic
995582705 5:113617731-113617753 GGCCTAGTGTGGGATCCACTAGG + Intergenic
995596383 5:113753055-113753077 GCCCCGGTGCAGGATCCACTAGG - Intergenic
995656581 5:114433104-114433126 GCCCCTGTGCAGGATCCACTGGG + Intronic
995678975 5:114695846-114695868 GCCCTGGCACGGGATCCACTAGG + Intergenic
995679795 5:114704225-114704247 GCCCCAGTGCGGGATCCACTAGG - Intergenic
995700474 5:114929331-114929353 GCCCCGGTGTGGGATCCTCTAGG + Intergenic
995920472 5:117305086-117305108 GCCCAGGTGCGGGATCCACTTGG + Intergenic
995975906 5:118034249-118034271 GTCCCAGTGTGGGATCCACTGGG + Intergenic
996107120 5:119517528-119517550 GCCCTGGTGTGGGATCCACTGGG + Intronic
996234297 5:121107600-121107622 GCCCCGCTGCGGGATCCACTGGG + Intergenic
996435775 5:123430978-123431000 GCCCCGGTGCGGGATCCACTGGG + Intergenic
996478624 5:123949126-123949148 GCCCCAGTGCGGGATCCACTAGG - Intergenic
996530476 5:124522046-124522068 GCCCCCGTGCGGGATCCACTGGG + Intergenic
996575816 5:124976055-124976077 GCCCCAGTGTGGGATCCACTAGG - Intergenic
997158120 5:131579973-131579995 GCCCTGGTGCTGGGTCCACTAGG - Intronic
997352287 5:133239383-133239405 GACCTGGTGCAGGATCCACTGGG + Intronic
997375579 5:133394773-133394795 AGCCCGGTGAGGGATCCACTAGG + Intronic
997760639 5:136444638-136444660 GCCCCGGTGCGGGATCCACTGGG + Intergenic
999348617 5:150845849-150845871 GGCCTGGTGCAGGATCCACTGGG + Intergenic
999406260 5:151309616-151309638 TCCCCGGTGTGGGATCCACTGGG + Intergenic
999460443 5:151753250-151753272 GCCTCTGAGCTGGAGCCACTAGG + Intronic
999855206 5:155586689-155586711 GCCCCCGTGCGGGATCCACTGGG - Intergenic
1000066111 5:157694262-157694284 GCCCCAGTGTGGCATCCACTGGG + Intergenic
1000084822 5:157879701-157879723 GCCTCGGTGTGGGATCCACTAGG + Intergenic
1000085945 5:157887267-157887289 GCCCCAGCGCGGGATCCACTAGG + Intergenic
1000329111 5:160193833-160193855 ACCCTGGTGCGGGATCCACTGGG - Intronic
1000432299 5:161166094-161166116 ACCCCTGTGTGGGATCTACTGGG - Intergenic
1000547688 5:162622268-162622290 GCCCCAGTGCGGGATCCACTGGG + Intergenic
1000568648 5:162882895-162882917 GCCCTGGCACGGGATCCACTAGG + Intergenic
1000609211 5:163356237-163356259 GCCCCCATGCAGGATCCACTGGG + Intergenic
1000862735 5:166476207-166476229 GCTCCTGGGAGGGACCCACTGGG - Intergenic
1000891739 5:166810132-166810154 GCCCCTGTGCGAGATCCACTGGG - Intergenic
1001425192 5:171618119-171618141 GCCCCTGGTCGAGGTCCACTGGG - Intergenic
1001841621 5:174881094-174881116 GCCCAGGTGCGGGATTCACTGGG + Intergenic
1001843638 5:174901941-174901963 GCCTCAGTGCAGGATCCACTGGG + Intergenic
1002004559 5:176221962-176221984 GCCCCGGTGCGGGATCCACTGGG - Intergenic
1002221816 5:177688658-177688680 GCCCCAGTGCGGGATCCACTGGG + Intergenic
1002308150 5:178296482-178296504 GCCCCTGCGTGGGATCCGCGGGG - Intronic
1002616527 5:180459598-180459620 GCCCCTGTGCAAGATCCACTAGG + Intergenic
1002681557 5:180969420-180969442 GCCCCTGCAGGGGATCCACTGGG - Intergenic
1002758095 6:180030-180052 GCCCCAGCGCAGGATCCACTAGG + Intergenic
1002789302 6:426137-426159 GCCCCGGTGCGGGATCCACTGGG - Intergenic
1002793275 6:450392-450414 GCCCCAGTGTGAGATCCACTGGG + Intergenic
1002817781 6:695004-695026 GGCCCCGGTCGGGATCCACTGGG + Intergenic
1002906950 6:1456907-1456929 GCCCCGGTAGGGGATCCACTGGG - Intergenic
1003040795 6:2685624-2685646 GCCACTGTGCGCTGTCCACTCGG - Intronic
1003060802 6:2860564-2860586 CCCCCAGTGTGGGGTCCACTGGG + Intergenic
1003069749 6:2936242-2936264 GCCCCAGTGCGAGATCCACTAGG + Intergenic
1003070288 6:2940017-2940039 GCCCCAGTACAGGATCCACTGGG + Intergenic
1003100270 6:3171188-3171210 GCCCCGGTACAGGATCCACTGGG + Intergenic
1003170777 6:3720702-3720724 GCCCCAGTGTGGGATCCACTAGG - Intergenic
1003176932 6:3758542-3758564 GCCCAGATGCGAGATCCACTGGG + Intergenic
1003178554 6:3772015-3772037 GCCCCGGTGCGAGATCCACTGGG + Intergenic
1003213813 6:4090514-4090536 GCCCCGGTATGGGATCCACTGGG + Intronic
1003224392 6:4191224-4191246 GCCCTGGTACGAGATCCACTGGG - Intergenic
1003489154 6:6606409-6606431 GCCCAGGTGCAGGATCCAGTGGG - Intronic
1003489969 6:6613214-6613236 GCCCTAGTGCCGGATCCACTGGG - Intronic
1003508765 6:6762417-6762439 GCCCCAGTGCGAGATCCACTGGG - Intergenic
1003531449 6:6940513-6940535 GCCCCAGTACAGAATCCACTGGG + Intergenic
1003578104 6:7315599-7315621 GCCCCAGTACGGGTTCCACGGGG + Intronic
1003578246 6:7316760-7316782 GCCCCGGTGTGGGATCCACTGGG - Intronic
1003581515 6:7344639-7344661 GCCCCGGTGCCGGATCCACTGGG + Intronic
1003589671 6:7426161-7426183 GCCCCAGTGCGGGATCCACTGGG + Intergenic
1003671615 6:8164757-8164779 GCCCCGGTGCCAGATCCACTGGG + Intergenic
1003717779 6:8666392-8666414 GCCCCGGTGTGGGATCCACTGGG + Intergenic
1003736972 6:8887589-8887611 GCCCCGGTGCGGGATCCACTAGG + Intergenic
1003748089 6:9024690-9024712 GCCCCCGTGCGGGACCCACTGGG + Intergenic
1003749633 6:9041114-9041136 GCACCAGTGCGAAATCCACTGGG + Intergenic
1003770074 6:9290380-9290402 GCCCCTGTGCGGAATCCACTGGG - Intergenic
1003836137 6:10074647-10074669 GCTCTGGTGCGGGATCCACTGGG - Intronic
1003845810 6:10172178-10172200 GCCCAGGTGCGGGATCCACTGGG + Intronic
1003862868 6:10337835-10337857 GCCCCGGTGCGGGATCCACTAGG + Intergenic
1003882002 6:10487724-10487746 GCCCTAGTGCAGGATCCACTGGG - Intergenic
1003896947 6:10616996-10617018 GCCCTGGTGCGGGATCCACTGGG - Intronic
1003901669 6:10660313-10660335 GCCCCAGTGCGGGATCCACTGGG + Intergenic
1003908207 6:10721013-10721035 GCCCTGGTGTGGGATCCACTGGG + Intergenic
1003947351 6:11087638-11087660 AGCGCTGTGCGGGATCCACTAGG + Intergenic
1003956754 6:11171487-11171509 GGCCCCGTGCGGGATCCACTGGG + Intergenic
1004045291 6:12017868-12017890 GCCCCAGTGCGGGATCCACTGGG - Intronic
1004196506 6:13510972-13510994 ACCCTGGTGGGGGATCCACTAGG - Intergenic
1004200344 6:13541964-13541986 GCCAGGGTGCAGGATCCACTGGG + Intergenic
1004224468 6:13772913-13772935 GCACCTATGCGGGATCCACTGGG + Intergenic
1004234344 6:13860567-13860589 GCCCCAGTGGGAGATCCACTGGG + Intergenic
1004338146 6:14783540-14783562 GCCCAGGTGTGGGATCCACTGGG - Intergenic
1004354147 6:14916388-14916410 GCCCTGGTGCGGGACCCACTAGG + Intergenic
1004483167 6:16040326-16040348 GCCCCCGCACGGGATCCACTAGG - Intergenic
1004486199 6:16069137-16069159 GCCCCTGTGCGGCATCTACTGGG - Intergenic
1004499594 6:16198036-16198058 GCCCCGGTGCGAGATCCACTGGG - Intergenic
1004501966 6:16217252-16217274 GCCCCAGTGCAGGACCCACTGGG + Intergenic
1004502081 6:16218157-16218179 ACCCCGGTGTGCGATCCACTGGG - Intergenic
1004503113 6:16226805-16226827 GCCCCAGTGCGGGATGCTCTGGG - Intergenic
1004647984 6:17581043-17581065 CCCCCGGTGCAGGATCCACTGGG + Intergenic
1004665458 6:17745244-17745266 GCTCCGGTGCGGGATCCACTGGG - Intergenic
1004689018 6:17976131-17976153 GCCCCGGTGCGGGATCCACTGGG - Intronic
1004861312 6:19806947-19806969 GCCCCAGTGCGGGATCCACTGGG - Intergenic
1004865976 6:19854370-19854392 GCCCCGGTGCGGGATCCACTGGG - Intergenic
1004906282 6:20239437-20239459 GCCCCGGTGCCGGATCCACTGGG + Intergenic
1004906862 6:20244707-20244729 GCCCTGGTGCGGGATCCACTAGG - Intergenic
1004912697 6:20301676-20301698 GCCCCAGTGCAGGATCCACTGGG + Intergenic
1004914505 6:20319305-20319327 GCCCCAATGCCAGATCCACTGGG + Intergenic
1005035495 6:21552219-21552241 GCCCCGGTGCGGGATCCACTAGG - Intergenic
1005042194 6:21609836-21609858 GCCCTGGTGTGGGATCCTCTGGG - Intergenic
1005059368 6:21761585-21761607 GGCCCGGTGCGGGATCCACTGGG + Intergenic
1005117642 6:22356335-22356357 GCCCTGGTGCAGGATCCACTGGG - Intergenic
1005332804 6:24765872-24765894 GCCCCGGCGCGGGATCCACTAGG - Intergenic
1005561506 6:27045657-27045679 GCCCCAGTGCGGGATCCACTGGG + Intergenic
1005600790 6:27424764-27424786 GCCCCAGCGCGGGGTCCACTGGG - Intergenic
1005707374 6:28469290-28469312 GCCCCAGTGCGGGATCCACTGGG - Intergenic
1005724989 6:28639721-28639743 TCCCTGGTGCGGGATTCACTGGG - Intergenic
1005749849 6:28872528-28872550 GCCCCAGTGCGGAATCCACTAGG - Intergenic
1005751227 6:28885071-28885093 GCCCCAGTGCGGGATCCACTAGG - Intergenic
1005758817 6:28949730-28949752 ACCCCGGTGCGGGATCCACTGGG - Intergenic
1005766393 6:29015504-29015526 GCCCGGGTGCAGGATCCACCAGG + Intergenic
1005976932 6:30807378-30807400 GCCCCAGTGTGGGGTCCACTAGG - Intergenic
1005978155 6:30816234-30816256 GCCCCGGTGCTGGATCCACTGGG - Intergenic
1006005851 6:31000889-31000911 GCCCCGGTGCGGGATCCACTGGG + Intergenic
1006007895 6:31017222-31017244 GCCCAGGTGCGGGATCCACTAGG + Intronic
1006008388 6:31021144-31021166 GCCCCGGGGCGGGATCCACTGGG + Intronic
1006128028 6:31852439-31852461 GCCCCAGTGCGGGATCCACTGGG + Intergenic
1006226993 6:32547860-32547882 GCCCTGGTGCGGGATCCACTAGG - Intergenic
1006352719 6:33532814-33532836 GCCCCAGTGCGGGATCCACTGGG + Intergenic
1006477908 6:34269450-34269472 GCCCCGGTGCGGGATCCACTAGG + Intergenic
1006696085 6:35931694-35931716 GCCCCAGTGCGGGATCCACTGGG + Intergenic
1006748822 6:36364168-36364190 GCCCCAGTGCAGGATCCACTGGG - Intronic
1006978287 6:38124265-38124287 GCTCCAGTGCGGTATCCACTGGG - Intronic
1007738802 6:43998480-43998502 GCCCTGGTGCAGGATCCACTGGG + Intergenic
1007774396 6:44216887-44216909 ACCCCTGTGCTGAATCCAGTGGG + Intergenic
1008005516 6:46405703-46405725 GCCCCGGTGCGAGATCTACTAGG - Intronic
1008230751 6:48983368-48983390 GGCCCTGTGTGGGATCCACTGGG - Intergenic
1008230967 6:48984327-48984349 GGCCCTGTGCGGGATCCACTGGG + Intergenic
1008254144 6:49275867-49275889 GCCCCGGTGTGGGATCCACTGGG + Intergenic
1008270110 6:49481763-49481785 GCCCCAGTGTGGGCTCCACTGGG - Intronic
1008270419 6:49483358-49483380 GCCCCAGTGTGGGATCCACTGGG - Intronic
1008284261 6:49629485-49629507 TGCCTGGTGCGGGATCCACTGGG - Intronic
1008567901 6:52786908-52786930 GCCCCGGTGTGGGATCCACTGGG + Intergenic
1008572450 6:52829120-52829142 GCCCCAGCGCAGGATTCACTAGG - Intergenic
1008587449 6:52962568-52962590 GCCTCAGTGCAGGATCCACTGGG - Intergenic
1008771073 6:54979660-54979682 GCCCTGGTGCGGGATCCACCAGG + Intergenic
1009402618 6:63274919-63274941 CCCCTGGTGCGGGATCCGCTGGG - Intergenic
1009407036 6:63326387-63326409 GCCCTGGTGCAGAATCCACTGGG - Intergenic
1009470344 6:64024158-64024180 GCCCTGGTGCGGGATCCACTGGG + Intronic
1009471481 6:64031546-64031568 GGCCCGGTGCAAGATCCACTGGG + Intronic
1009510735 6:64547662-64547684 GCCCCAGTATGGGATCCACTGGG - Intronic
1009587722 6:65627965-65627987 GCCCCGGTGCGGGATCCACTAGG + Intronic
1009685417 6:66949638-66949660 AGCCCCGTGCGGGATCCACTGGG + Intergenic
1009739353 6:67723475-67723497 GCCCTGGTGTGGGATCCACTAGG + Intergenic
1009746751 6:67825816-67825838 GCCCTGGTGCAGGATCCACTAGG + Intergenic
1009800787 6:68533814-68533836 GCCCCAGTGCCAGATCCACTGGG + Intergenic
1009872345 6:69467634-69467656 GCCCTGGTGTGGGATCCACTGGG + Intergenic
1010199237 6:73268810-73268832 GCCCTGGTGCAGGATCCACTAGG - Intronic
1010235565 6:73572468-73572490 CCCCCAGTGCGGGATCCACTGGG - Intergenic
1010269423 6:73903577-73903599 GCCCCAGTACCGGATCCACTAGG + Intergenic
1010270441 6:73910404-73910426 GCTCTGGTGCAGGATCCACTAGG + Intergenic
1010617460 6:78030226-78030248 GCCCCGGTGCGGGATCCACTAGG + Intergenic
1011129250 6:84037415-84037437 GCCCTGGCGTGGGATCCACTAGG - Intronic
1011143767 6:84189792-84189814 GCCCCGGTGCGGGATCCACTAGG + Intronic
1011178187 6:84587815-84587837 GCCCCAATGCGGGATCCACTGGG + Intergenic
1011246596 6:85326392-85326414 GCCCTGGTGCGGGATCCACTGGG + Intergenic
1011601662 6:89065337-89065359 GCCCCGGTGCGGGATCCATTGGG + Intergenic
1011620026 6:89234425-89234447 GCCCTGGTGCAGGATCCACTGGG - Intergenic
1011870009 6:91881830-91881852 GCCCGGGTGCGGGATCCACTAGG - Intergenic
1011879859 6:92011687-92011709 AGCCCAGTGCGGGATCCACTAGG - Intergenic
1011974836 6:93283029-93283051 GCCCCGGTGCGGGATCCATTGGG + Intronic
1012131369 6:95497366-95497388 GCCCCGGCGCGGGATCCACTAGG + Intergenic
1012145101 6:95670465-95670487 GCCATGGTGCAGGATCCACTAGG + Intergenic
1012189265 6:96260882-96260904 GCCCCTGTGTGGGATCCACTGGG - Intergenic
1012578154 6:100829168-100829190 GCCCAGGTGCGGGATCCACTGGG - Intronic
1012598415 6:101066607-101066629 GCCCTGGCGTGGGATCCACTAGG - Intergenic
1012598930 6:101070684-101070706 GCCCTGGTGCAGGATCCTCTAGG + Intergenic
1012733484 6:102910656-102910678 GCCCCAGTGTGGGATCCACTGGG - Intergenic
1012760425 6:103294340-103294362 GCCCCGGTGCGGGATCCACTGGG - Intergenic
1012851063 6:104446709-104446731 GGCCCACTGCAGGATCCACTGGG + Intergenic
1013080303 6:106806180-106806202 GCCCCGGTGCGGGACCCACTGGG + Intergenic
1013081408 6:106816698-106816720 GCCCTGGTGCGGGATCCACTAGG - Intergenic
1013143491 6:107364181-107364203 GCCCCAGTGCGGGATCCACTAGG - Intronic
1013410709 6:109881082-109881104 GCCCCGGTGCAGGATCCACTGGG - Intergenic
1013694733 6:112689303-112689325 GCCCCGGTGCGGGATCCACTGGG - Intergenic
1013853301 6:114541786-114541808 GCCCTGGTGCAGGATCCACTGGG - Intergenic
1013955269 6:115834536-115834558 ACCCGGGTGCAGGATCCACTAGG - Intergenic
1013963375 6:115928018-115928040 GCCCTGGTGCGGGATCCGCATGG - Intergenic
1014055962 6:117015177-117015199 GCCCCAGTGCGAGATCCACTGGG + Intergenic
1014240819 6:119015748-119015770 GCCCCGGTGCGGGATCCACTAGG + Intronic
1014280881 6:119441428-119441450 GCCCCAGTGCGAGATCCACTGGG + Intergenic
1014499204 6:122165064-122165086 GCCCCGGTGTGGGATCCACTGGG - Intergenic
1014507838 6:122281004-122281026 GCCCAGGTGCGGGATCCACTGGG + Intergenic
1014586379 6:123202381-123202403 GCCCTGGTGTGGGATCTACTAGG + Intergenic
1014718635 6:124892397-124892419 GCCCTAGTGCGGGATCCACTGGG + Intergenic
1014739080 6:125126278-125126300 GCCCCAGTGCGGGATCCACTGGG + Intronic
1014788550 6:125644877-125644899 GCCCCGGTGCAGGATCCACTGGG + Intergenic
1014920996 6:127214526-127214548 GCCCCGGTGCCGGATCCACTGGG - Intergenic
1015572172 6:134633480-134633502 GCCCCGGTGCGGGATCCACTGGG - Intergenic
1015600424 6:134905154-134905176 GCCCTGGTGCGGGATCCACTGGG + Intergenic
1016067293 6:139697860-139697882 GCCCCGGTGCAGGATCCACTGGG - Intergenic
1016069819 6:139726272-139726294 GCCCCGGTGAGGGATCCACTAGG - Intergenic
1016092751 6:139999520-139999542 GCTCCAGTGCGGGATCCACTGGG - Intergenic
1016104655 6:140148057-140148079 GGTCCGGTGCGAGATCCACTGGG - Intergenic
1016172864 6:141041560-141041582 GCCCCTGTGCGGGATCCACTAGG - Intergenic
1016217279 6:141618638-141618660 GCCCCGGTGCAGGATCCACTGGG + Intergenic
1016482237 6:144495086-144495108 GCCCGGGTGCGGGATCCACTGGG - Intronic
1016858722 6:148697129-148697151 GCCCCGGTGGGGGATCTACTGGG - Intergenic
1017299056 6:152834768-152834790 GCCCCGGTGCGGGATCCACTAGG + Intergenic
1017325170 6:153134046-153134068 GCCCCAGTACGGGATCCACTGGG + Intergenic
1017537451 6:155363495-155363517 GCCCTGGTGCGGGATCGACTGGG + Intergenic
1017581138 6:155866691-155866713 GCCCCGGTGCGGGATCCACTGGG - Intergenic
1018064159 6:160114453-160114475 GCCCCGGTGTGGGATCCACTGGG - Intergenic
1018551269 6:165001567-165001589 GGCCCTGTGCGGCATCCACTAGG - Intergenic
1018624570 6:165765223-165765245 GCCCCCGTGCGGGATCCACTGGG - Intronic
1018915380 6:168129577-168129599 GCCCATGTGCGGAAACCACCAGG - Intergenic
1018919426 6:168161145-168161167 GCCCCTGGGCTGGAACCTCTGGG - Intergenic
1019000188 6:168743720-168743742 GCCCCGGTGCGGGATCCACTAGG - Intergenic
1019086302 6:169480464-169480486 GCCCCAGAGCGGGATCCACTAGG + Intronic
1019752065 7:2737072-2737094 GCCCATGTGTGGGTCCCACTGGG + Intronic
1019944187 7:4313873-4313895 GCCCCTGTGCGGGATCCACTGGG - Intergenic
1019965676 7:4496866-4496888 GCCCCTGTGCGGGATCCACTGGG - Intergenic
1020008347 7:4793912-4793934 GCCCCTGTGCAGGATCCACTGGG + Intronic
1020163990 7:5793917-5793939 GCCCCAGTGCGGGATCCACTGGG + Intergenic
1020662124 7:10995490-10995512 GCCCTGGTGCGGGATCCACTGGG - Intronic
1020784356 7:12556098-12556120 GCCCCAGTGTGGGATCCACTGGG - Intergenic
1021133948 7:16943410-16943432 GCCCCAGTGCGGGATCCACTAGG + Intergenic
1021324200 7:19245908-19245930 GCCCAGGTGCGGGATCCACTAGG + Intergenic
1021359331 7:19692187-19692209 GCCCCTGTGTGGGATCCACTAGG - Intergenic
1021513726 7:21461134-21461156 GCCCTGGTGCGAAATCCACTGGG - Intronic
1021520637 7:21536525-21536547 GCCCCGGTGTGGGATCCACTGGG - Intergenic
1021567818 7:22032303-22032325 GCCCCAGTGCGGGATCCACTGGG - Intergenic
1021573984 7:22090850-22090872 GCCCTGGCGCAGGATCCACTAGG + Intergenic
1021686689 7:23193668-23193690 GCCCTGGTGTGGAATCCACTGGG - Intronic
1022174072 7:27856992-27857014 GCCCTGGTGCAGGATCCACTGGG - Intronic
1022386259 7:29901917-29901939 CCCCCTGTTTGGGAACCACTAGG - Intronic
1022750515 7:33219397-33219419 GCCCCAGTGCAGGGTCCACTGGG + Intronic
1023128011 7:36974162-36974184 GCCCCGGTGTGGTATCCACTGGG + Intronic
1023378061 7:39577821-39577843 GGCCCAGTGCAGGATCCACGAGG + Intronic
1023396132 7:39753886-39753908 GCCCAGGTGCGAGATCCACTGGG - Intergenic
1024269155 7:47628901-47628923 GCCCCGGTGCGGGATCCACTGGG + Intergenic
1024335556 7:48202849-48202871 GCCCTGGTGCGGGATCCACTGGG - Intronic
1024443910 7:49454058-49454080 GCTCCAGTGCAGGATCCACTGGG + Intergenic
1024465982 7:49711681-49711703 GCCCCAGTGTGGGATCCACTGGG + Intergenic
1024700559 7:51900821-51900843 GCCCCAGTGCCAGATCCACTGGG - Intergenic
1024735737 7:52302830-52302852 GCCCTTGTGCGGGATCCACTGGG - Intergenic
1024741844 7:52363031-52363053 GCCCAGGTGCGGGACCCACTGGG + Intergenic
1024748126 7:52431178-52431200 GCCCCGGCGCGGGATCCACCAGG - Intergenic
1024825353 7:53385097-53385119 GCCCTGGTGCGGGATCCACTAGG - Intergenic
1024834123 7:53495445-53495467 GCCCCAGTGCGGGATCCACTGGG + Intergenic
1025039313 7:55626379-55626401 GCCCCTGTGTGGGATTAACAAGG - Intergenic
1025182597 7:56831119-56831141 GCCCCTGTGAGGCATCAGCTTGG + Intergenic
1025962002 7:66231297-66231319 GCCCCGGTGCGGGATCCACTGGG - Intronic
1026187018 7:68090350-68090372 GCCCCGTTGTGGGATCCACTAGG - Intergenic
1026203022 7:68231456-68231478 GCCCCAGTGCGAAAGCCACTGGG + Intergenic
1026335968 7:69394250-69394272 GCCCCGGTGCGGGATCCACTCGG + Intergenic
1026512418 7:71038019-71038041 GCCCCGGTGCAGGATCCACTGGG + Intergenic
1026516644 7:71078411-71078433 GCCCCGGTGTGGGATCCACTGGG + Intergenic
1026596483 7:71738015-71738037 GCCCTGGTGTGGGATCCACTAGG - Intergenic
1026896337 7:74012125-74012147 GCCACTGTTCGGGCTCCATTGGG - Intergenic
1027561751 7:79739725-79739747 GCCCCGGTGCGGGATCCACTGGG + Intergenic
1027579638 7:79977540-79977562 GCCCCAGTGCAGGATCCACTGGG - Intergenic
1027665967 7:81043132-81043154 GCCCCAGTGCAGGATCCACTAGG + Intergenic
1027667460 7:81057419-81057441 GCCCTGGTGCGGGATCCACTGGG - Intergenic
1027674554 7:81142162-81142184 GCCCCGGTGCGGGATCCACTGGG + Intergenic
1027698207 7:81437026-81437048 GCCCCAGTGCGGGATCCACTGGG - Intergenic
1027779025 7:82499994-82500016 GCCCCAGTGTGGGATCCACTGGG + Intergenic
1027868174 7:83673735-83673757 GCCCCAGTGCGGGATCCACTGGG + Intergenic
1028070177 7:86440992-86441014 GCCCTGGTGCTGGATCCACTGGG + Intergenic
1028303225 7:89228705-89228727 ACCCCGGTGTGGGATCCACTGGG - Intronic
1028392755 7:90334837-90334859 ACCCTAGTGCGGGATCCACTGGG + Intergenic
1028511141 7:91627329-91627351 GCTCTGGTGCGGGATCCACTAGG - Intergenic
1028719348 7:94011808-94011830 GCCCCACTGCAGGATCCACTAGG - Intergenic
1028727240 7:94101259-94101281 GCCCCAGTGCGGGATCCACTAGG + Intergenic
1028778399 7:94705917-94705939 GCCCCGGTGCGGGATCCACTGGG + Intergenic
1028852441 7:95552402-95552424 GCCCCGGTGTGGGATCCACTGGG - Intergenic
1028857237 7:95605687-95605709 GCCCCCATGTGGGATCCACTAGG + Intergenic
1028913068 7:96229132-96229154 GCCCCAGTGCGGGATCTACTAGG + Intronic
1028989582 7:97034770-97034792 GCCCCAGTGAGAGATCCACTGGG + Intergenic
1029037971 7:97541547-97541569 GCCCTGGCGTGGGATCCACTAGG + Intergenic
1029076214 7:97936306-97936328 GCTCCTGTGCGGGATCCACTGGG + Intergenic
1029567582 7:101348999-101349021 GCCCCGGTGTGGGATTCACTGGG + Intergenic
1029809563 7:103034180-103034202 GCCCCAGTGCGAGATCCACTGGG - Intronic
1029832303 7:103274861-103274883 GCCCCAGTGCAGGATCCACTAGG - Intergenic
1029904029 7:104072184-104072206 GCCCCAGTGCGGAATCCACTGGG + Intergenic
1030102060 7:105955747-105955769 GGCCGGGTGCTGGATCCACTGGG - Intronic
1030215655 7:107042298-107042320 GCCCCAGTGCGGGATCCACTGGG - Intergenic
1030292725 7:107888242-107888264 GCCCCAGCGCAGGATCCACTGGG + Intergenic
1030366947 7:108657186-108657208 GCCCCAGTGCAGCATCCACTGGG - Intergenic
1030733565 7:113017770-113017792 GCCCCGGTGCGGGATCCACTGGG + Intergenic
1030780490 7:113593742-113593764 GTCCCGGTGCGGGATCCACTGGG + Intergenic
1030819241 7:114076787-114076809 GCCCCGGTGCCGTATCCACTGGG - Intergenic
1030980618 7:116181919-116181941 GCCCCAGTGCGGGATCCACTGGG - Intergenic
1031056462 7:116997933-116997955 GCCCCAGTGCGGGATCCACTAGG - Intronic
1031110039 7:117596533-117596555 GCCCCAGTGCGGGATCCACTGGG + Intronic
1031292186 7:119951447-119951469 CCCCCAGTGTGGGATCCACTAGG - Intergenic
1031378868 7:121060360-121060382 CCCCCGGTGCGGGATCCACTGGG + Intronic
1031409285 7:121422151-121422173 GCCCCAGTGCGGGATCCACTGGG + Intergenic
1031513218 7:122673751-122673773 GCCCTGGTGTGGGATCCACTAGG - Intronic
1031605461 7:123763154-123763176 CGCCTGGTGCGGGATCCACTGGG - Intergenic
1031902944 7:127429588-127429610 GCCCTGGTGCAGGATCCACTAGG + Intronic
1032248144 7:130230446-130230468 GCCCCTGTGCGGGATCCACTAGG + Intergenic
1032437197 7:131909748-131909770 GCCCTGGTGCGGGATCCACCAGG + Intergenic
1032561528 7:132898543-132898565 GCCTGGGTGCGGGATCCACTGGG - Intronic
1033065148 7:138146545-138146567 GCCCCAGTGCGAGATCCACTGGG + Intergenic
1033269364 7:139916813-139916835 GCCCTTGTGCGGGGGCCACAGGG + Intronic
1033281900 7:140012080-140012102 GCCCGTGTACGGGATTCATTAGG + Intronic
1033394021 7:140956891-140956913 GCCCCAGTGCAGGATCCACTAGG - Intergenic
1033664027 7:143424334-143424356 GCCCTGGTGCGGGATCCACTGGG - Intergenic
1033779396 7:144650848-144650870 GCCCCGGTGCGGGATCCACTAGG + Intronic
1033839832 7:145360532-145360554 GCCTCCGTGGGAGATCCACTGGG - Intergenic
1033866571 7:145697349-145697371 GCCCCGGTGCGGGATCCACTGGG - Intergenic
1034091121 7:148364232-148364254 GCCCCAGTGCGGGATCCACTAGG + Intronic
1034097990 7:148426832-148426854 GCCCCAGTGCGGGATCCACTGGG + Intergenic
1034155093 7:148949505-148949527 GCCCCGGTGCGGGATCCACTAGG + Intergenic
1034167682 7:149038635-149038657 GCCCCGGTGTGGGATCCACTAGG - Intergenic
1034632065 7:152538824-152538846 GCCCCGGTGCGGGATCCACGGGG - Intergenic
1034651847 7:152697545-152697567 GCCCCAGTGCAGGATCCACTGGG + Intergenic
1034900926 7:154907324-154907346 GCCCCAGCACGGGATCCACTAGG + Intergenic
1034967023 7:155398081-155398103 GCCCCAGTGCGAGATCCACTGGG - Intergenic
1035151112 7:156873942-156873964 GCCCTAGTGCGGAATCCACTGGG - Intronic
1035325487 7:158062993-158063015 GCCCTGGTGCAGGATCCACTAGG + Intronic
1035463822 7:159063083-159063105 GGCCCGGTGCAGGATACACTAGG - Intronic
1035608295 8:944191-944213 GTCCCTGTGAGTGATTCACTGGG + Intergenic
1035608303 8:944223-944245 GTCCCTGTGGGTGATCCAGTGGG + Intergenic
1035608358 8:944481-944503 GTCCCTGTGGGTGATCCATTGGG + Intergenic
1035683498 8:1507105-1507127 GCCCCAGCGCAGGATCCGCTAGG - Intronic
1036123752 8:6044997-6045019 GCCTCCGTGTGGGATCCACTGGG - Intergenic
1036135133 8:6153130-6153152 GGCCCCGTGCAGGATCCACTAGG + Intergenic
1036260538 8:7236074-7236096 GCTCCTGTGCTGGGTCCACTGGG + Intergenic
1036306075 8:7603448-7603470 GCTCCTGTGCTGGGTCCACTGGG - Intergenic
1036312575 8:7694630-7694652 GCTCCTGTGCTGGGTCCACTGGG + Intergenic
1036356921 8:8051433-8051455 GCTCCTGTGCTGGGTCCACTGGG - Intergenic
1036378334 8:8219296-8219318 ACCCCCGTGTGGGACCCACTTGG + Intergenic
1036440953 8:8781328-8781350 GCCCCGGTGCGGGATCCACTGGG - Intergenic
1036554590 8:9847736-9847758 GCCCTGGTGCGGGATCCACTGGG - Intergenic
1036801440 8:11795186-11795208 GGCCCTGCGCGGGATCCACTGGG + Intergenic
1036831426 8:12023026-12023048 GCTCTTGTGCGGGATCCACTGGG + Intergenic
1036901649 8:12673829-12673851 GCTCCTGTGTGGGATCCACTGGG + Intergenic
1036915052 8:12796687-12796709 GCCCCGGTGCAGGATCCACTGGG + Intergenic
1036952449 8:13154177-13154199 GCCCTGGCACGGGATCCACTAGG - Intronic
1037065103 8:14567260-14567282 ACACCAGTGCGGGATCCACTGGG + Intronic
1037173756 8:15923726-15923748 GCCCCAGGGACGGATCCACTAGG + Intergenic
1037239430 8:16760477-16760499 GCCCTGGTGTGGGATCCACTAGG - Intergenic
1037241627 8:16784330-16784352 GCCCCGGTGTGGGATCCACTAGG + Intergenic
1037263769 8:17036754-17036776 GCCCTGGTGCGGGATCCACTGGG - Intronic
1037425535 8:18750980-18751002 GCCCCGGTGCGGGATCCACTGGG - Intronic
1037559008 8:20055149-20055171 GCCCCTGTGCGAGATCCCCTGGG + Intergenic
1037811058 8:22086992-22087014 GCCCCGGTGCGGGATCCACTCGG + Intergenic
1037957472 8:23070717-23070739 ACCCCGGTGCGGGATCCACTGGG - Intergenic
1037971265 8:23173735-23173757 GCCCCAGTGCGGGATCCACTAGG - Intergenic
1038174141 8:25164919-25164941 GCCCCGGTGCGGGACCCACTAGG + Intergenic
1038638351 8:29304678-29304700 GCCCCTGTGCAGGATCCACTGGG + Intergenic
1038639481 8:29311886-29311908 GCCCCTGTGCGGGATCCACTGGG + Intergenic
1038847532 8:31244086-31244108 ACACTGGTGCGGGATCCACTGGG - Intergenic
1038870772 8:31490291-31490313 GCCCCAGTGCGAGATCCACTGGG + Intergenic
1039068810 8:33632104-33632126 GCCCCGGTGCAGGATTCACTGGG + Intergenic
1039069032 8:33633764-33633786 GCCGCAGTGCGGGTTCCACCGGG - Intergenic
1039284927 8:36029250-36029272 GCCCCAGTGCAGGATCCACTAGG + Intergenic
1039587682 8:38720220-38720242 GCCCCGGTGCCCGATCCACTGGG + Intergenic
1040000947 8:42575629-42575651 GCCCTGGTGCAGGATCCACTAGG + Intergenic
1040003618 8:42599993-42600015 GCCCTGGCGTGGGATCCACTAGG - Intergenic
1040026617 8:42787179-42787201 GCCCTGGTGCGGGATCCACCAGG + Intronic
1040276934 8:46018610-46018632 GCCTCTGTGTGGGGTCCACTGGG - Intergenic
1040351347 8:46571949-46571971 GCCCCAGTGCAGGATCCACTGGG + Intergenic
1040622154 8:49102939-49102961 GCCCCGGTGCGAGATCCACTGGG - Intergenic
1040701861 8:50075278-50075300 GCCCCTGGGTGGGATCCACTAGG + Intronic
1040723201 8:50350342-50350364 GCCCTGGTGCGGGATCCACTGGG + Intronic
1040791080 8:51231025-51231047 AGCCCGGTGCGAGATCCACTGGG + Intergenic
1040794238 8:51271658-51271680 GCCCCAGTGCAGGATCCACTAGG + Intergenic
1040804411 8:51377943-51377965 AGCCCCGTGCGGTATCCACTGGG + Intronic
1040806762 8:51404760-51404782 ACCCTGGTGCAGGATCCACTGGG - Intronic
1040952636 8:52952793-52952815 GCCCTGGTGCGGGATCCACTAGG - Intergenic
1040954069 8:52961789-52961811 GCCCTGGTGCGGGATCCACTAGG + Intergenic
1040954846 8:52969770-52969792 GCCCCAGTGTGAGATCCACTGGG - Intergenic
1040964512 8:53071081-53071103 GCCCCAGCACAGGATCCACTAGG - Intergenic
1041034587 8:53775837-53775859 GCCCCAGTGCGGGACCCACTGGG - Intronic
1041068609 8:54104619-54104641 GCCCCAGTGCAGGATCCACTAGG + Intergenic
1041604283 8:59761935-59761957 GGCCCTTTGCAGGATCCACTGGG - Intergenic
1041636591 8:60152904-60152926 GCCCTGGTGTGGGATCCACTGGG - Intergenic
1041914596 8:63126498-63126520 GCCCCGGTGCGGGATCCACTGGG + Intergenic
1041919002 8:63162413-63162435 GCCCTGGTGCGGGATCCACTAGG + Intergenic
1042336097 8:67631140-67631162 GCCCCGGTGTGGGATCTACTAGG + Intronic
1042948680 8:74179468-74179490 GCCCCTGTGCGGGATCCACTAGG - Intergenic
1043073267 8:75665402-75665424 GCCCCGGTGCGGGATCCACTGGG - Intergenic
1043110173 8:76169995-76170017 GCCCCAGTGCATGATCCACTGGG + Intergenic
1043129861 8:76447552-76447574 GTCCCCGTGCGGGATCCACTGGG - Intergenic
1043346534 8:79303918-79303940 GCCCGGGAGCGGGATCCACTAGG + Intergenic
1043352417 8:79377140-79377162 GCCCCGGTGCGGGATCCACTGGG - Intergenic
1043435400 8:80232232-80232254 GGCCCGGTGCGGGATCCACTAGG + Intergenic
1043620965 8:82192193-82192215 TCCCCGGTGCAGGATCCACTAGG - Intergenic
1043640237 8:82441802-82441824 GCCCCGGTAAGGGATCCACTGGG + Intergenic
1043701194 8:83290774-83290796 GCCCCGGTGCAGGATCCACTGGG + Intergenic
1043709958 8:83403370-83403392 GCCCCGGTGTGGGATCCACTAGG + Intergenic
1043725921 8:83611098-83611120 GCCCTGGTGCAGGATCCACTAGG - Intergenic
1043731876 8:83693934-83693956 GCCCCAGTATGGGATCCACTGGG - Intergenic
1043857231 8:85276450-85276472 GCCCTGGTGCGAGATCCACTGGG + Intronic
1044075897 8:87821258-87821280 GCCCCGGTGCAGGATCCACTGGG + Intergenic
1044088559 8:87971538-87971560 GCCCTGATGCGGGATCCACTGGG + Intergenic
1044404959 8:91816745-91816767 GCCCAGGTGCGGGATCCACTGGG + Intergenic
1044441720 8:92231199-92231221 GCCCAAGTGCAGGATCGACTAGG + Intergenic
1044633399 8:94300270-94300292 GCCCCGGTGTGGGATCCACTGGG - Intergenic
1044788761 8:95824063-95824085 GCCCTGGTGCGGGATCCACTGGG + Intergenic
1044862083 8:96533783-96533805 GCCCCAGTGCAGGATCCATTGGG - Intronic
1044880595 8:96719023-96719045 GCCCCGGTGCGGGATCTACTGGG - Intronic
1045131871 8:99163336-99163358 GCCCCGGTGCGGGATCCACTAGG - Intronic
1045232256 8:100316709-100316731 GCCCTGGTGCGGGATCCACTAGG - Intronic
1045467686 8:102485450-102485472 GCCCTGGTGCGGGATCCATTGGG - Intergenic
1045743276 8:105387269-105387291 GCCCCAATGCGGGATCCACTGGG - Intronic
1046149271 8:110202513-110202535 GGCCCGGTGCGGGATCCACTGGG - Intergenic
1046208814 8:111040774-111040796 GCCCCAGTGCGAGATCCACTGGG - Intergenic
1046251954 8:111643249-111643271 GGCCCCGTGTGGGATCCACTAGG + Intergenic
1046265321 8:111823227-111823249 GCTCCAGTGCGGGATCCACTAGG - Intergenic
1046284980 8:112082956-112082978 GCCCCCTTGCGGGATCCACTGGG - Intergenic
1046288982 8:112133116-112133138 GCCCTGGTGCGGGATCCACTGGG + Intergenic
1046445415 8:114311774-114311796 GCCCTGGTGCGGGATCCACTGGG + Intergenic
1046450784 8:114386579-114386601 GCCCTGGTGCGGGATCCACTGGG + Intergenic
1046521321 8:115330503-115330525 GCCCCTGTGTGGGATCCACTAGG - Intergenic
1046621282 8:116531468-116531490 GGCCCCGTGCGGGATCCACTGGG + Intergenic
1047100116 8:121667382-121667404 GCCCCGGTGTGTGATCTACTGGG - Intergenic
1047124834 8:121948500-121948522 GCCCCAGTGCGGGATCCACTGGG + Intergenic
1047631627 8:126714574-126714596 GCCCCAGTGCGGGGTCCACTGGG - Intergenic
1048060811 8:130917654-130917676 TCCCCTGAGCGGGATCAACAAGG - Intronic
1048112925 8:131487451-131487473 ACCCCGGTGCCTGATCCACTGGG + Intergenic
1048186819 8:132249595-132249617 GCCCCGGTGCAGGATCCACTAGG - Intronic
1048575967 8:135690394-135690416 GCCCCAGTGTGGAATCCACTGGG - Intergenic
1048655343 8:136530389-136530411 GCCTCAGTGTAGGATCCACTGGG - Intergenic
1048676889 8:136793743-136793765 TGACCGGTGCGGGATCCACTGGG - Intergenic
1048757423 8:137755056-137755078 GCCCTGGTGTGGGATCCACTGGG - Intergenic
1049087561 8:140490453-140490475 GCCCCAGTGTGGGATCCACTGGG - Intergenic
1049157766 8:141077064-141077086 GCCCCGGTGCGGGATCCACTGGG + Intergenic
1049401643 8:142430277-142430299 GCCCCTGTGCAGCTTCCTCTAGG + Intergenic
1049500387 8:142959900-142959922 GCCCCGGTGCGGGATCCACTGGG + Intergenic
1049857998 8:144875551-144875573 GCCCTGGTGTGGGATCCACTGGG + Intergenic
1049944438 9:580708-580730 GCCCCAGTGCGGGATCCACTAGG - Intronic
1050250020 9:3734189-3734211 GGCTGAGTGCGGGATCCACTGGG + Intergenic
1050294990 9:4195699-4195721 GCCACAGCGCGGGATCCACTAGG + Intronic
1050920687 9:11197289-11197311 GCCCCAGTGCAGGATCCACTAGG + Intergenic
1050975189 9:11928839-11928861 GCCCCGGTGTGGGATTCACTGGG - Intergenic
1051305012 9:15699981-15700003 GCCCGGGTGCGGGATCCACTGGG - Intronic
1051383381 9:16480930-16480952 AGCCTGGTGCGGGATCCACTGGG + Intronic
1051419656 9:16877058-16877080 AGCCCAGTGCGGGATCCAATGGG - Intergenic
1051425020 9:16924354-16924376 AGCCCGGTGCGGGATCCACTAGG - Intergenic
1051439929 9:17073026-17073048 GCCCCCGTGCGGGATCCACTGGG + Intergenic
1051449326 9:17178349-17178371 GCCCGGGTGCGGGATCCACTGGG - Intronic
1051459270 9:17294619-17294641 GCCCCTGTGCGGGATACACTGGG - Intronic
1051463874 9:17354359-17354381 GCCCCGGTGCGGGATCCACTGGG + Intronic
1051892766 9:21959674-21959696 GCCCTGGTGCAGGATCCACTAGG + Intronic
1052056605 9:23914396-23914418 GCCCCAGTGCGGGATCCACTGGG - Intergenic
1052075521 9:24135490-24135512 GCCCCGGTGCAGGACCCACTGGG + Intergenic
1052313496 9:27093034-27093056 GCCCCGATGGGGGACCCACTGGG + Intergenic
1052576648 9:30299687-30299709 ACCCCAGTGTGGGATCCACTAGG + Intergenic
1052979626 9:34438369-34438391 GCACCGGTGCGGGATCCACTGGG + Intronic
1052985276 9:34482701-34482723 GCCCCGGTGGGGGATCCACTAGG - Intronic
1053027206 9:34740173-34740195 GCCCCGGTGCGGAATCCACTGGG - Intergenic
1053547840 9:39042294-39042316 GCCCCTGTGCGGGATCCACTAGG - Intergenic
1053811964 9:41862335-41862357 GCCCCGGTGTGGGATCCACTAGG - Intergenic
1053928353 9:43089786-43089808 GCCCCAGCGCGGGATCCGCTAGG + Intergenic
1054285354 9:63163505-63163527 GCCCCAGCGCGGGATCTGCTAGG - Intergenic
1054291448 9:63296979-63297001 GCCCCAGCGCGGGATCTGCTAGG + Intergenic
1054389466 9:64601518-64601540 GCCCCAGCGCGGGATCTGCTAGG + Intergenic
1054618631 9:67325104-67325126 GCCCCGGTGTGGGATCCACTAGG + Intergenic
1054722529 9:68617447-68617469 GCCCTGGTGCCGGATCCACTGGG + Intergenic
1055049437 9:71963961-71963983 GCCCCGGAGTGGGATCCACGGGG + Intronic
1055102495 9:72480176-72480198 GCCCTGGTGCGGGATCCACTGGG - Intergenic
1055248511 9:74275877-74275899 GCCCCCGTGCGGGATCCACTGGG - Intergenic
1055461388 9:76523665-76523687 GCCCCTGTGTGGGATCCACTGGG - Intergenic
1055557510 9:77490321-77490343 ACCCCAGTGTGGGATCCACTAGG - Intronic
1055651446 9:78410418-78410440 GCCCCAGTGCGGGATCCACTGGG + Intergenic
1055814080 9:80185228-80185250 GCCCTGGTGCTGGATCCACTGGG - Intergenic
1055985452 9:82054318-82054340 GCCCCGGTGCAGGATCCACTGGG - Intergenic
1056677181 9:88685862-88685884 GGCCTGGTGAGGGATCCACTAGG - Intergenic
1056736006 9:89209782-89209804 GCACTGGTGTGGGATCCACTGGG + Intergenic
1056743824 9:89282848-89282870 GCCCCAGTGCGCGATCCAGTGGG + Intergenic
1056771321 9:89480355-89480377 GCCCCGGTGCGGGATCCACTAGG - Intronic
1056914112 9:90729914-90729936 GCCCCTGTGCCAGATCCACTGGG + Intergenic
1057118243 9:92545668-92545690 AGCCTGGTGCGGGATCCACTGGG + Intronic
1057300775 9:93880332-93880354 ACCCCAGTGCAGGATCCACTGGG + Intergenic
1057383851 9:94591081-94591103 GCCCCGGTGCGGGATCCACTAGG - Intronic
1057511210 9:95680754-95680776 TCCCCCGTGCGGCATCCACTGGG + Intergenic
1057543787 9:96001656-96001678 GCCCCGGTGCGGGATCCACTGGG - Intronic
1057628557 9:96700825-96700847 GCCCCGGTGTGGGATCCACTAGG - Intergenic
1057726984 9:97574597-97574619 GCCCCGGTGCAGGATCCACTGGG + Intronic
1057907118 9:98992056-98992078 GCCCTCGTGCGGGATCCACTAGG - Intronic
1058174795 9:101724052-101724074 GCCCCGGTGCAGGATCCACTGGG - Intronic
1058235622 9:102486920-102486942 GCCCTGGTATGGGATCCACTGGG - Intergenic
1058286639 9:103187314-103187336 GCCTGGGTGCGGAATCCACTGGG + Intergenic
1058309568 9:103484099-103484121 GCCCCTGCAGGGGATCCACTAGG + Intergenic
1058365250 9:104201017-104201039 GCCCCAATGCAGGATCCACCAGG + Intergenic
1058379498 9:104362840-104362862 GGCCCAGTGTGGGATCCACTAGG - Intergenic
1058585311 9:106501277-106501299 GGCCCGGTGCGCGATCCACTGGG - Intergenic
1058727605 9:107818225-107818247 GCCCCGGTGTGAGATCCACTGGG + Intergenic
1058786571 9:108393936-108393958 GCCCCGGTGCAGGATCCACTAGG + Intergenic
1059434528 9:114268002-114268024 GCCCCTCTGCGGGCTCCCCTGGG - Intronic
1059791083 9:117642702-117642724 GCCCCGGTGCGGGATCCACTGGG - Intergenic
1059810688 9:117852408-117852430 GCCCCGGTGTGGGATCCACTGGG + Intergenic
1059891376 9:118809196-118809218 GCCCAGGTGCGGGATCCACTGGG - Intergenic
1059991490 9:119870219-119870241 GCCCCGGTGCGGGATCCACTAGG - Intergenic
1060091417 9:120746768-120746790 GCCCGGGTGCGGGATCCACTGGG + Intergenic
1060594156 9:124838670-124838692 GCCCTGGTGCGGGATCCACTGGG - Intergenic
1061483903 9:130910545-130910567 GTCCCGGTGCGGGATCCACTAGG + Intronic
1061929651 9:133825770-133825792 GCCCCAGGGCAGGATCCAATGGG + Intronic
1062146136 9:134990969-134990991 GCCCCAGTGCGGGATCCACTGGG - Intergenic
1203429867 Un_GL000195v1:80743-80765 GACCCTGTGGGGGATCCACTGGG + Intergenic
1203460361 Un_GL000220v1:30958-30980 GCCCTGGTGTGGGATCCACTGGG - Intergenic
1203662446 Un_KI270753v1:57753-57775 GGCCAGGTGCGGGATCCACTAGG + Intergenic
1203662804 Un_KI270753v1:61341-61363 GCCCTGGTGCAGGATCCACTGGG - Intergenic
1203670562 Un_KI270755v1:7355-7377 GCCCTGGTGCAGGATCCACTGGG + Intergenic
1186152523 X:6690445-6690467 GCCCCGGTGCGGGATCCACTGGG - Intergenic
1186282020 X:8003254-8003276 GCCCCAGTGTGGGATCCACTAGG - Intergenic
1186293282 X:8122031-8122053 GGCCCAGTGCCAGATCCACTGGG + Intergenic
1186295580 X:8144908-8144930 GCCCCAGTGCAGGATCCACCGGG - Intergenic
1186323180 X:8452428-8452450 GCCCCGGTGCGGGATCCACTGGG - Intergenic
1187005776 X:15231668-15231690 GCCCTCGTACGGGATCCACTAGG - Intergenic
1187139126 X:16575875-16575897 GCCCCAGTGCGGGATCCACTGGG + Intergenic
1187304676 X:18084226-18084248 GCCCCAGTGTGGGATCCACTAGG + Intergenic
1187557504 X:20366787-20366809 GCCCCAGTGCGGGATCCACTAGG - Intergenic
1187904085 X:24050115-24050137 GCCCCGGTGCCGGATCCACTGGG + Intergenic
1188112072 X:26205182-26205204 GCCCCAGTGGGAGATCCACTGGG + Intergenic
1188166891 X:26873638-26873660 GCCCCAGTGCGGGATCCACTGGG - Intergenic
1188189598 X:27157426-27157448 GCCCCAGTGCGGGATCCACTGGG + Intergenic
1188242749 X:27809714-27809736 GCCCCAGTGCGGGATCCACTGGG + Intronic
1188881908 X:35499701-35499723 GGCCCGGTGCAGGACCCACTGGG + Intergenic
1189209906 X:39276003-39276025 GCCCTGGTGCGGGATCCACTGGG + Intergenic
1189896774 X:45664755-45664777 GCCATGGTGCAGGATCCACTGGG - Intergenic
1190045796 X:47110941-47110963 GCCCAGGTGCGGGATCCACTGGG - Intergenic
1190413894 X:50163269-50163291 GCCCCGGTGCAGGATCCACTGGG - Intergenic
1191249958 X:58255542-58255564 GCCCCTGTGCTGGGCCCTCTGGG - Intergenic
1191618569 X:63192510-63192532 GCCCCGATGCGGGATCCACTGGG - Intergenic
1192186825 X:68952537-68952559 GCCCCAGTGCGGGATCCACTGGG + Intergenic
1192251482 X:69417185-69417207 GCCCCAGTGCGGGATCCACTGGG + Intergenic
1192869594 X:75173535-75173557 GCCCCGGTGTAGGATCCACTAGG - Intergenic
1192870501 X:75179454-75179476 GCCCTGGTGTAGGATCCACTAGG - Intergenic
1192924461 X:75741057-75741079 GTCCCTGTGAGGGTTGCACTGGG - Intergenic
1193040137 X:76996596-76996618 GCCCCAGTGCGGGATCCACTGGG - Intergenic
1193271138 X:79531005-79531027 GCCCCAGTGCGAGATCCACTGGG + Intergenic
1193538088 X:82738141-82738163 GCCCCGGTGCGGGATCCACTAGG - Intergenic
1193708898 X:84856583-84856605 GGCCCGGTGCAGGATCCACTGGG - Intergenic
1193803966 X:85972296-85972318 GCCCTGGTGCGGGATCCACTGGG - Intronic
1193951697 X:87808633-87808655 GCCCAGGTGTGGGATCCACTAGG - Intergenic
1194025528 X:88746312-88746334 GGCCTAGTGCAGGATCCACTGGG - Intergenic
1194071532 X:89330967-89330989 GCCCCAGTGTGGGATCCACTAGG - Intergenic
1194121142 X:89965584-89965606 GCCCCGGTGCGAGATCCACTAGG - Intergenic
1194166415 X:90521758-90521780 GCCCCAGTGCGGGATCCACTAGG + Intergenic
1194197619 X:90914893-90914915 GCCCCAGCAAGGGATCCACTAGG - Intergenic
1194204546 X:90995825-90995847 GCCCCTGTGTGGGATCCATTAGG + Intergenic
1194340372 X:92699423-92699445 GCCCTGGTGCGGGATCCACTAGG - Intergenic
1194384455 X:93236160-93236182 GCCCCAGTGCGGGATCCACTGGG + Intergenic
1194650750 X:96512189-96512211 GCCCCGGTGCGGGATCCACTAGG - Intergenic
1195257965 X:103107286-103107308 GCCCCAGTGTGGGATCCACTGGG - Intergenic
1195259300 X:103117048-103117070 GGCCCTGTGCGGGATCCACTGGG - Intergenic
1195460202 X:105115688-105115710 GGCCCAGTGCGGGACCCACTGGG - Intronic
1195896295 X:109749272-109749294 GCCCCAGTGAGGGATCCACTGGG - Intergenic
1195909534 X:109875832-109875854 GCTCCTGTGCGGGATCCACTGGG - Intergenic
1196319462 X:114270498-114270520 GCCCCGGTGCCGGATCCACTGGG - Intergenic
1196569363 X:117247723-117247745 GTCCCAGCGCAGGATCCACTAGG + Intergenic
1196582760 X:117395103-117395125 GCCCCAGTGCGGGATCCATTGGG + Intergenic
1196616223 X:117769456-117769478 GCCCTGGTGCGGGATCCGCTGGG + Intergenic
1196662460 X:118282679-118282701 GCCCCTGTGCGGGATCCACTAGG - Intergenic
1196705837 X:118716874-118716896 GCCCCAGTGCGGGATCCACTGGG - Intergenic
1196714682 X:118799379-118799401 GCCCCTGTGCGGGATCCACGAGG + Intergenic
1196728863 X:118921921-118921943 GTCCCGGTGCGGGATCCACTAGG - Intergenic
1196741583 X:119029938-119029960 GCCCCGGTGTAGGATCCACTAGG + Intergenic
1196761907 X:119208410-119208432 GCCCTGGTGCGGGATCCACTAGG - Intergenic
1196762277 X:119210817-119210839 GCCCTGGTGCGGGTTCCACTAGG - Intergenic
1196771571 X:119300104-119300126 GCCCTGGTGCGGGATCCACTAGG + Intergenic
1196775273 X:119332297-119332319 GCCCTGGTGCGGGATCCACTAGG + Intergenic
1196781397 X:119387522-119387544 GGCCCAGTGCGGGATCCACTAGG - Intergenic
1196793913 X:119487801-119487823 GCCCCAGTGTGGGATCCACTAGG - Intergenic
1196827199 X:119750759-119750781 GCCCCAGTGCGGGATCCACTAGG - Intergenic
1196845126 X:119891013-119891035 GCCCTGGTGTGGGATCCACTGGG + Intergenic
1196860786 X:120025706-120025728 GCCCAGGTGCGGGATCCACTGGG - Intergenic
1197000214 X:121431466-121431488 GCCCTGGGGCAGGATCCACTGGG - Intergenic
1197331105 X:125155406-125155428 GCCCCAGTACGAGATCCACTGGG - Intergenic
1197340118 X:125256057-125256079 GCCCCAGTGCGAGATCCACTGGG + Intergenic
1197344761 X:125319000-125319022 GCCCTGGTGCGGGATCCACTAGG - Intergenic
1197376728 X:125690516-125690538 GCCCCAGTGCGAAATCCACTGGG - Intergenic
1197533711 X:127662951-127662973 GCCCCTGTGCGGGATCCACTGGG - Intergenic
1197608014 X:128607047-128607069 GCCGTGGTGCGGGATCCACTGGG + Intergenic
1197978825 X:132194508-132194530 GCCCCTGTGGGGGATCCACTAGG + Intergenic
1198256209 X:134926051-134926073 GCCCCTGTGCAGGATCCACTAGG + Intergenic
1198300057 X:135325877-135325899 GCCCCGGTGCAGGATCCACTGGG + Intronic
1198468176 X:136921786-136921808 GCCCCGGTGCAGGATCCACGGGG + Intergenic
1198664245 X:139003963-139003985 GCCCCGGTGCAGGATCCACTCGG - Intronic
1198694527 X:139321226-139321248 GCCCCGGTGGGGGATCCACTGGG + Intergenic
1198872246 X:141188476-141188498 GCCCCAGTGCGAGACCCACTGGG - Intergenic
1198972518 X:142298183-142298205 GCCCCTGTGCGGGATCCACTGGG - Intergenic
1199009868 X:142745661-142745683 ACCCCGCTGCGGGATCCACTAGG - Intergenic
1199028733 X:142972074-142972096 GTCCCGGTGCAGGATCCACTAGG - Intergenic
1199050163 X:143228629-143228651 GCCCCTGTGCGGGATCCCCTGGG - Intergenic
1199094764 X:143726172-143726194 GCCCTAGCGTGGGATCCACTAGG - Intergenic
1199134101 X:144231189-144231211 GCCTCGGTGCGGGATCCACTGGG - Intergenic
1199175610 X:144784041-144784063 GCCCCGGTGCGGGATCCACTAGG + Intergenic
1199356173 X:146866820-146866842 GCCCCTGTGCGGGATCCACTGGG - Intergenic
1199408086 X:147485877-147485899 GCCCCTGTGTATGATCCACATGG - Intergenic
1199628175 X:149758948-149758970 GCCCTGGTGCCCGATCCACTGGG + Intergenic
1199831210 X:151551124-151551146 GCCCCGGTGCAGGATCCACTAGG - Intergenic
1199831726 X:151555129-151555151 GCCCCGGTGCAGGATCCACTGGG - Intergenic
1199832867 X:151562600-151562622 GGCCCCCTGTGGGATCCACTGGG - Intergenic
1200108975 X:153729428-153729450 GCCCCTGGCCTGGATCCTCTTGG - Intronic
1200205226 X:154310788-154310810 GACCCTGTGGGGGATCATCTGGG - Intronic
1200423493 Y:2998313-2998335 GCCCCGGTGCGGGATCCACTAGG - Intergenic
1200470823 Y:3584028-3584050 GCCCTGGTGTGGGATCCACTGGG - Intergenic
1200512685 Y:4099539-4099561 GCCCCGGTGCGGGATCCACTGGG + Intergenic
1200550386 Y:4571266-4571288 TCCCCTGTGTGAGATCCATTAGG + Intergenic
1200648741 Y:5816175-5816197 GCCCTGGTGCGGGATCCACTAGG - Intergenic
1200725770 Y:6666696-6666718 GCCCCAGTGTGGGATCCACTAGG - Intergenic
1200824224 Y:7622154-7622176 GCCCCGGTGTGGGATCCACTAGG - Intergenic
1200873563 Y:8128458-8128480 GGGCAGGTGCGGGATCCACTGGG - Intergenic
1200888741 Y:8299039-8299061 GCCCCGGTGCGGGATCCACTGGG + Intergenic
1200955389 Y:8938751-8938773 GCCCTGGCGCAGGATCCACTAGG + Intergenic
1201232570 Y:11879496-11879518 GCCCCGGCGCAGGATCCACTAGG - Intergenic
1201260892 Y:12158380-12158402 GCCCTTTTGCAGGATCTACTAGG - Intergenic
1201422978 Y:13820143-13820165 GCCCCTGTGCGAGATCCACTGGG - Intergenic
1201424321 Y:13831762-13831784 GCCCTGGTGCCAGATCCACTAGG + Intergenic
1201430558 Y:13897580-13897602 GTCCTGGTGCAGGATCCACTGGG + Intergenic
1201468404 Y:14309666-14309688 GCCCCAGTGTGGGATCCACTGGG + Intergenic
1201469168 Y:14314873-14314895 GCCCCAGTGCGGGATCCACTGGG + Intergenic
1201480005 Y:14428513-14428535 GCCCCGGTGCGGGATCCACTAGG + Intergenic
1201487137 Y:14506073-14506095 GCCCTGGTGCTGGATCAACTGGG + Intergenic
1201488227 Y:14513236-14513258 GCCCCGGTGCTGGATCAACTGGG + Intergenic
1201495626 Y:14589721-14589743 GCCTCGGTGTGGGATCCACTAGG - Intronic
1201496869 Y:14598135-14598157 GCCCCAGTGCGGGATCCACTAGG - Intronic
1201499503 Y:14627250-14627272 GCCCCAGCGCGGGATCCACTAGG - Intronic
1201556374 Y:15267676-15267698 GCCCTGGTGTGGGATCCACTGGG + Intergenic
1201715879 Y:17043536-17043558 GCCCCGGTGAGGGATCCACTGGG + Intergenic
1201901040 Y:19046502-19046524 GCCCCAGTGCCAGATCCGCTGGG - Intergenic
1201982552 Y:19923655-19923677 GCCCTGGTGCGGGATCCACTAGG - Intergenic
1202109909 Y:21407624-21407646 GCCCCAGTGCGCGATCCACTGGG + Intergenic
1202137020 Y:21676601-21676623 GCCCCGGTGCGGGATCCACTGGG - Intergenic
1202202357 Y:22367088-22367110 GGCCGGGTGTGGGATCCACTAGG - Intronic
1202235830 Y:22708933-22708955 GCCCCGGTGTGGGATCCACTAGG + Intergenic
1202307333 Y:23487235-23487257 GCCCCGGTGTGGGATCCACTAGG - Intergenic
1202563472 Y:26183351-26183373 GCCCCGGTGTGGGATCCACTAGG + Intergenic