ID: 985403794

View in Genome Browser
Species Human (GRCh38)
Location 4:189616589-189616611
Sequence GGATCCCGCACAGGGGCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1857
Summary {0: 38, 1: 317, 2: 516, 3: 423, 4: 563}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985403780_985403794 21 Left 985403780 4:189616545-189616567 CCAGGTCCCCACCAGACTCAGGA 0: 14
1: 737
2: 800
3: 512
4: 1029
Right 985403794 4:189616589-189616611 GGATCCCGCACAGGGGCTGCAGG 0: 38
1: 317
2: 516
3: 423
4: 563
985403788_985403794 -4 Left 985403788 4:189616570-189616592 CCAGCTGGCTTCACCCAGTGGAT 0: 862
1: 802
2: 346
3: 181
4: 237
Right 985403794 4:189616589-189616611 GGATCCCGCACAGGGGCTGCAGG 0: 38
1: 317
2: 516
3: 423
4: 563
985403785_985403794 10 Left 985403785 4:189616556-189616578 CCAGACTCAGGAGCCCAGCTGGC 0: 1016
1: 565
2: 314
3: 310
4: 533
Right 985403794 4:189616589-189616611 GGATCCCGCACAGGGGCTGCAGG 0: 38
1: 317
2: 516
3: 423
4: 563
985403783_985403794 13 Left 985403783 4:189616553-189616575 CCACCAGACTCAGGAGCCCAGCT 0: 903
1: 749
2: 401
3: 335
4: 763
Right 985403794 4:189616589-189616611 GGATCCCGCACAGGGGCTGCAGG 0: 38
1: 317
2: 516
3: 423
4: 563
985403782_985403794 14 Left 985403782 4:189616552-189616574 CCCACCAGACTCAGGAGCCCAGC 0: 889
1: 747
2: 391
3: 420
4: 588
Right 985403794 4:189616589-189616611 GGATCCCGCACAGGGGCTGCAGG 0: 38
1: 317
2: 516
3: 423
4: 563
985403787_985403794 -3 Left 985403787 4:189616569-189616591 CCCAGCTGGCTTCACCCAGTGGA 0: 849
1: 786
2: 340
3: 179
4: 241
Right 985403794 4:189616589-189616611 GGATCCCGCACAGGGGCTGCAGG 0: 38
1: 317
2: 516
3: 423
4: 563
985403781_985403794 15 Left 985403781 4:189616551-189616573 CCCCACCAGACTCAGGAGCCCAG 0: 905
1: 703
2: 377
3: 429
4: 653
Right 985403794 4:189616589-189616611 GGATCCCGCACAGGGGCTGCAGG 0: 38
1: 317
2: 516
3: 423
4: 563

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985403794 Original CRISPR GGATCCCGCACAGGGGCTGC AGG Intergenic
900144116 1:1150586-1150608 TGAACCCTCACAGGGGCTGCAGG + Intergenic
900420556 1:2554251-2554273 GGGTCCTGCACAGGGCCTGGCGG + Intergenic
901045910 1:6395718-6395740 GGGTCCCGCACTGGGGCTGCAGG + Intergenic
901439201 1:9267332-9267354 AAATCCGGCACAGGGGCTGCGGG - Exonic
901449641 1:9328181-9328203 GGATTCAGTACAGGGGCTGAGGG + Intronic
901783417 1:11609132-11609154 GGGTCCCACACCGGGGCTGCAGG - Intergenic
901988052 1:13091665-13091687 GGGCCCCACCCAGGGGCTGCTGG + Intergenic
901993760 1:13135102-13135124 GGGCCCCACCCAGGGGCTGCTGG - Intergenic
902032544 1:13433791-13433813 GGATCCCACACCGGGGCCGCAGG + Intergenic
902033519 1:13439663-13439685 GGATCCCCTACCGGGGCCGCAGG - Intergenic
902100354 1:13983107-13983129 GGATCTCGCACGGGGGCTGCAGG + Intergenic
902877629 1:19350239-19350261 GGCTGCAGCACAGGAGCTGCGGG - Intronic
904238817 1:29131088-29131110 GGATCCCACACCGGGGCCACAGG + Intergenic
905038193 1:34930430-34930452 GGAGCCCGGACACAGGCTGCGGG + Intergenic
905095238 1:35464714-35464736 GCAGCCCTCACAGGGGCTGGAGG + Intronic
905185972 1:36197079-36197101 GAATCCCGCGCCAGGGCTGCAGG - Intergenic
905375705 1:37518668-37518690 GGATCCCGCACCGGGGCTGCAGG - Intergenic
905742970 1:40388268-40388290 GGATCTCGCACTGGGGCTGCAGG - Intronic
906083062 1:43107307-43107329 GGATCTCGCACCAGGGCCGCAGG + Intergenic
906563432 1:46778453-46778475 GGATTCTGCACCGGGGTTGCAGG + Intronic
906813159 1:48850067-48850089 GAAGCCCAGACAGGGGCTGCTGG - Intronic
906876215 1:49541735-49541757 GGATCCTGCACAGGGGCCACAGG - Intronic
906877637 1:49556652-49556674 GGATCCCGCGCAGGGGCCGCAGG + Intronic
907102160 1:51847322-51847344 GGATCCAGCACCGGGCCAGCAGG + Intronic
907980127 1:59472501-59472523 GGATCCCGCACCGGGGCTGCAGG - Intronic
908291416 1:62670306-62670328 GGATCCCGCACCAGGGCTGCAGG - Intronic
908416249 1:63915899-63915921 GGATCCCACACAGGAGATACTGG - Intronic
908888661 1:68818124-68818146 GGATCTCGCACTGGGGCTGCAGG - Intergenic
909317952 1:74247844-74247866 AGATCCCACGCAGGGGCCGCAGG + Intronic
909318470 1:74253281-74253303 GGATCCCGCACAGGGGCCGCAGG + Intronic
909377002 1:74951992-74952014 GGATCCTGCACCAGGGCTGCAGG + Intergenic
909548158 1:76869168-76869190 GGATCCCGAGCAGTGGCCGCGGG - Intronic
909759312 1:79269536-79269558 GGATCCTGCACCGGGGCTGCAGG - Intergenic
909904491 1:81178551-81178573 GGATCCGGCACCGGGGCTGCAGG + Intergenic
910034693 1:82776726-82776748 GGATCCCGCACCAGGGCTGCAGG + Intergenic
910478754 1:87636173-87636195 GGATCCCGCACCAGGGCCACAGG + Intergenic
910550373 1:88467485-88467507 GGATCCGGCACTGGGGCCCCAGG - Intergenic
910609679 1:89127985-89128007 GGATCCCGCACAGGGGCTGCAGG + Intronic
911001520 1:93170645-93170667 GGATCCCGCACCTGGGCCGCAGG - Intronic
911205990 1:95091783-95091805 AGATCCTGCACCGAGGCTGCAGG - Intergenic
911259522 1:95669572-95669594 GGATCCCACACCGGTGCTGCAGG + Intergenic
911305158 1:96224282-96224304 GGATCCCACGCTGGGGCTGCAGG + Intergenic
911954425 1:104217388-104217410 GGATCCCGCACTGGGGCTGCAGG + Intergenic
912166234 1:107045184-107045206 GGATCCCACACCTGGGCTGCAGG - Intergenic
912312801 1:108640813-108640835 GGATCCCGCACCGGGGCTGCAGG + Intronic
912316002 1:108667892-108667914 GGATCCTGCACCAGAGCTGCAGG - Intergenic
912538680 1:110396275-110396297 GGATCTCGCACTGGGGCCGCAGG + Intergenic
912822777 1:112881091-112881113 GGATCCTGCCAAGAGGCTGCAGG + Intergenic
913160992 1:116146498-116146520 GGATCCCGCACTGGGGCTGCAGG + Intergenic
913469074 1:119171921-119171943 GGATCCCGCACCGGGGCCGCAGG - Intergenic
913470257 1:119179440-119179462 GGATCCTGCACCAGGGCCGCAGG - Intergenic
913682236 1:121197192-121197214 GGATCCCGCACAGGGGAGCAGGG - Intronic
913692040 1:121289048-121289070 GGATCCCGCACCGGGGCTGCAGG + Intronic
913987168 1:143575471-143575493 GGATCTCGCACCAGGGCCGCAGG - Intergenic
914034072 1:143984813-143984835 GGATCCCGCACAGGGGAGCAGGG - Intergenic
914145518 1:144991066-144991088 GGATCCCGCACCGGGGCTGCAGG - Intronic
914155374 1:145083157-145083179 GGATCCCGCACAGGGGAGCAGGG + Intronic
914438361 1:147680710-147680732 GGATCCCGCACCAGGGCTGCAGG + Intergenic
914928132 1:151906553-151906575 GGATCTCGCACTGGGGCTGCAGG - Intronic
915104197 1:153522193-153522215 GGATCCTGCACCAGGGCTGCAGG - Intergenic
915242254 1:154532033-154532055 GGATCTCGCACCGGGGCCACAGG + Intronic
915260139 1:154671178-154671200 GGATCCCACATCAGGGCTGCAGG - Intergenic
915261309 1:154678465-154678487 GGATCCCACATCAGGGCTGCAGG - Intergenic
915321799 1:155060567-155060589 TTATCCAGCACAGGGGCTCCTGG - Intronic
915666031 1:157446227-157446249 GGATCTCCCACGGGGGCTACAGG + Intergenic
915767091 1:158374100-158374122 GGATACCGCACCTGGGCTGCAGG + Intergenic
916219941 1:162433568-162433590 GGATCCTGCACTGGGGCTGCAGG - Intergenic
916448453 1:164895498-164895520 GGGTCCAGGACAGAGGCTGCAGG + Intronic
916605876 1:166342804-166342826 GGATCCTGCACCAGGGCCGCAGG + Intergenic
916910036 1:169337018-169337040 GGATCCCGCACCGGGGCTGCAGG + Intronic
916939100 1:169661589-169661611 GGATCCCACACCAGGGCTGCAGG - Intergenic
916940138 1:169668427-169668449 GGATCCCACGCCGGGGCTGCTGG - Intronic
916960359 1:169882527-169882549 GGATCCCGCACTGGGGCTGCAGG - Intronic
916991540 1:170250665-170250687 GGATCCCACGCAGGGGCCCCAGG + Intergenic
917348793 1:174056353-174056375 GGATCCCGCACTGGGGCTGTAGG + Intergenic
917445338 1:175102244-175102266 GGATCCCGCACTGGGGCTGCAGG + Intronic
917446293 1:175108401-175108423 GGATCCCGCACTGGGGCTGCAGG + Intronic
918051100 1:180972997-180973019 GGATGGCGCACAGTGACTGCGGG + Exonic
918059086 1:181046245-181046267 GGATCCCCCACTGGGGCTGCAGG - Intronic
918154649 1:181832827-181832849 GGATCCTGCACCAGGGCCGCAGG - Intergenic
918659689 1:187073760-187073782 GGATCCCGCACGGGGGCTGCAGG + Intergenic
918709018 1:187704036-187704058 GGATCCCGCACCGGGGCTGCAGG - Intergenic
918720908 1:187850618-187850640 GGATCCCGCACAGGGGCTGCAGG - Intergenic
918790044 1:188813435-188813457 GGATCCCGCACTGGGGCCGCAGG - Intergenic
918791965 1:188841119-188841141 GGATCCTGCACTGAGGCTGCAGG + Intergenic
918853137 1:189718243-189718265 GGATCCCGCACGAGGGCTGCCGG + Intergenic
918942912 1:191025944-191025966 GGATCCCGCACCAGGGCCACAGG + Intergenic
918952069 1:191151798-191151820 GTATCCCGCACCGGGGCTGCAGG - Intergenic
919049711 1:192499021-192499043 GGATCCTGCACTGGGGCCACAGG + Intergenic
919091980 1:192987325-192987347 GGATCCCACACCAGGGCTGCGGG - Intergenic
919167879 1:193918856-193918878 GGATCCCGCACCAGCGCTGCAGG + Intergenic
919174545 1:194002255-194002277 GGATCCCGCACCAGGGCTGCAGG - Intergenic
919201277 1:194358213-194358235 GGATGCCACACCAGGGCTGCAGG + Intergenic
919237092 1:194859416-194859438 GGATCCCGCACCGGTGCTGCAGG - Intergenic
919250904 1:195054694-195054716 GGATCCCTTACTGGGGCTGCAGG - Intergenic
919297702 1:195722858-195722880 GGATCCAGCACGGGGGCTGCAGG + Intergenic
919419697 1:197355339-197355361 GGATCCCACGCAGGGGCCGCAGG + Intronic
919631019 1:199960036-199960058 GGTTCCCGCACTGGGGCCGCAGG - Intergenic
920214847 1:204354875-204354897 GGGGCGCGGACAGGGGCTGCAGG + Intronic
920469549 1:206215703-206215725 GGATCCCGCACAGGGGAGCAGGG - Intronic
920479361 1:206307396-206307418 GGATCCCGCACCGGGGCTGCAGG + Intronic
920731296 1:208488382-208488404 GGATCCCACACTGGGGCTGCAGG + Intergenic
920756759 1:208740094-208740116 GGATCCCGCACCGGGGCTGCTGG - Intergenic
920878383 1:209858593-209858615 GGATACCGCAGCGGGGCCGCAGG + Intergenic
920881951 1:209888892-209888914 GGATCCCGCACCCGGGCTGCAGG + Intergenic
920883077 1:209898745-209898767 GGATCCCGCACCGGGGCTGCAGG + Intergenic
921094330 1:211874208-211874230 GGATCCCGCACAGGGGCCACAGG + Intergenic
921396303 1:214673091-214673113 GGATCCCGCACCCGGGCTGCAGG + Intergenic
921801883 1:219411068-219411090 GGATCCGGCACCGGGGCTGCAGG - Intergenic
921897168 1:220412848-220412870 GTATCCCGCACCGGGGCTGCAGG - Intergenic
921903758 1:220475612-220475634 GGATCCAGCACGGGGGCTGCAGG + Intergenic
921912158 1:220561275-220561297 GCATGCAGCCCAGGGGCTGCAGG - Intronic
922056900 1:222050162-222050184 GGATCCCGCACAGGGGCTGCAGG - Intergenic
922306904 1:224352463-224352485 GGATTCACCACGGGGGCTGCAGG + Intergenic
922423287 1:225473123-225473145 GGATCCCGCACCGGGGCTGCAGG - Intergenic
922541834 1:226426238-226426260 GGATCACGCACCAGGGCTGCAGG + Intergenic
922855868 1:228774120-228774142 GGATCCCGCACCGGGGCTGCAGG - Intergenic
922985952 1:229865872-229865894 GGATCCCGCACCAGGGCTGCGGG - Intergenic
923172531 1:231430763-231430785 GGATCCCGCACTGGGGCCGCAGG + Intergenic
923193382 1:231641893-231641915 GGATCCCGCACCGGGGCTACAGG + Intronic
923278013 1:232415422-232415444 AGATGCCGCACAGGCCCTGCAGG + Intronic
923324738 1:232871388-232871410 GGATCCCGCACCGGGGCTGCAGG + Intergenic
923353259 1:233129536-233129558 GGATCCCACACTGAGGCCGCAGG - Intronic
923573894 1:235140710-235140732 GGATCCTGCACCGGGGCTGCAGG - Intronic
923810446 1:237309574-237309596 GGATCCCACACAAGGGCCGCAGG + Intronic
923930004 1:238684576-238684598 GGATCCCCCACAGGGGCTGCAGG + Intergenic
924117599 1:240762904-240762926 GGATCCCGCACCGGGGCTGCAGG - Intergenic
924835084 1:247639558-247639580 GGATCCCGCCCTTGGGCCGCCGG + Intergenic
1062934303 10:1374710-1374732 TGATACCGCACAGGGGAAGCCGG - Intronic
1063148871 10:3319758-3319780 GGATCCCACACCTGGGCTGCAGG + Intergenic
1063309240 10:4937371-4937393 GGATCCCGCACCAGGGCCGCAGG + Intronic
1063318648 10:5032463-5032485 GGATCCCGCACCGGGGCTGCAGG + Intronic
1063322122 10:5060631-5060653 GGATCCCACACTGGGGCTGCAGG + Intronic
1063769774 10:9183766-9183788 GGATCCCGCACCAGGGCTGCAGG - Intergenic
1064197863 10:13260022-13260044 GGATCCGGCACTGGGGCTGCAGG - Intergenic
1064461104 10:15535353-15535375 GGATCCCGCACCGGCGCCGCAGG - Intronic
1064790285 10:18951223-18951245 GGATCCCACACCAGGGCTGCAGG + Intergenic
1065441413 10:25756414-25756436 GGATCCCGTACCGGGGCTGCAGG - Intergenic
1065554980 10:26905960-26905982 GTATCCTGCACAGGGGCTGCAGG - Intergenic
1065743204 10:28815618-28815640 GGATCCCGCACAGGGGCTGCAGG + Intergenic
1065802681 10:29366595-29366617 GGATCCCACACCAGGGCTGCAGG - Intergenic
1065895959 10:30163228-30163250 GGATCCCGCACAGGGGCTGCAGG - Intergenic
1065995584 10:31056236-31056258 GGATCCTGCACCAGGGCCGCAGG - Intergenic
1066190343 10:33049642-33049664 GGATCCCGCACCGGGGCTGCAGG - Intergenic
1066234122 10:33468449-33468471 GGATCCCACACCGGGGCTGTAGG - Intergenic
1066235380 10:33480412-33480434 GGATCCCACACCGGGGCTGCAGG + Intergenic
1066296171 10:34055931-34055953 GGATCCCGCACGGGGGCTGCAGG - Intergenic
1066567324 10:36734563-36734585 GGATCCCGCACTGGGGCTGCAGG + Intergenic
1066598270 10:37076379-37076401 GGATCCTGCACTGGGGCCTCAGG - Intergenic
1066614992 10:37285112-37285134 GGATCCCACACCAGGGCTGCGGG + Intronic
1066660953 10:37737745-37737767 GGATCCCGCACGGGGGCCACAGG - Intergenic
1067363270 10:45601157-45601179 GGATCCCACACCAGGGCTGCAGG - Intergenic
1067757113 10:49013627-49013649 GGAACCCACACATGGGCTGAGGG + Intergenic
1068211403 10:53924595-53924617 GGATCCTGCACTGGGGCCGCAGG - Intronic
1068216756 10:53991228-53991250 GGATCCCACGCCGGGGCTGCAGG - Intronic
1068374099 10:56155540-56155562 GGATCCCGCACCAGGGCTGCAGG - Intergenic
1068455605 10:57250256-57250278 GGATGCCGCCCTGGGGCTGCAGG - Intergenic
1068460436 10:57321892-57321914 GGATCCCGCCCAGGGGCTGCAGG - Intergenic
1068792347 10:61041030-61041052 GGATCCCGCACCAGGGCTGCAGG - Intergenic
1068902192 10:62280794-62280816 GGATCCCACACCAGGGCTGCAGG - Intergenic
1068978216 10:63034005-63034027 GGATCCCGCACCGGGGCTGCAGG - Intergenic
1069186445 10:65429352-65429374 GGATCCCGCACAGGGGCTGCAGG + Intergenic
1069552707 10:69375684-69375706 GGCTCCCGCAGAGGAGCGGCGGG + Intronic
1069633296 10:69910596-69910618 GGGGGCAGCACAGGGGCTGCTGG - Intronic
1069723972 10:70565890-70565912 GAATCCCCCACTGGGGCTGGGGG + Intronic
1069728123 10:70594235-70594257 GGATACTGCCCAGGGGATGCAGG - Intergenic
1069756095 10:70775246-70775268 GGATCCGACACAGGAGCTCCAGG + Exonic
1069766221 10:70862077-70862099 GGATCCCGCACCGGGGCTGCGGG - Intronic
1069988756 10:72301019-72301041 GGATCCCGCACCAGGGCCGCAGG - Intergenic
1069993051 10:72326370-72326392 GGATCGTGCACCGGGGCTGCAGG - Intergenic
1070564017 10:77590225-77590247 GGATCCCGCACCGGGGCCGCAGG + Intronic
1070937958 10:80315817-80315839 GGATCCCGCACTGGGGCCACAGG - Intergenic
1070942492 10:80359441-80359463 GGATCCCGCATCAGGGCTGCAGG + Intronic
1070968381 10:80543630-80543652 GGATCCCGCACTGGGGCTGCAGG - Intronic
1070973455 10:80586290-80586312 GGATCGCGCACCAGGGCCGCAGG - Intronic
1071003834 10:80859670-80859692 GGATCCCGCACCGGGGCTGCAGG - Intergenic
1071037404 10:81264858-81264880 GGATCCTACACCAGGGCTGCAGG + Intergenic
1071041012 10:81309019-81309041 GGATCCCGCACCGGGACTGCAGG + Intergenic
1071055761 10:81506189-81506211 GGATCCTGCACCAGGGCTGCAGG - Intergenic
1071078787 10:81784634-81784656 GGATCCTGCACTGGGGCAGCAGG - Intergenic
1071085280 10:81862629-81862651 GGATCCTGCACTGGGGCCACAGG + Intergenic
1071289358 10:84177261-84177283 GTTCCCTGCACAGGGGCTGCAGG + Intronic
1071388077 10:85141816-85141838 GGATCCCGCACAAGGGCTGCAGG - Intergenic
1071797012 10:89018598-89018620 GGATCCTGCACCGGGGCTGCAGG + Intergenic
1071900933 10:90119774-90119796 GGATCCCACACCGGGGCTGCAGG + Intergenic
1071963710 10:90832119-90832141 GGATCTGGCACTGGGGCTGCAGG + Intronic
1072278559 10:93845569-93845591 AGCTCCCACACTGGGGCTGCAGG - Intergenic
1072341773 10:94459438-94459460 GGATCCTGTGCTGGGGCTGCGGG + Intronic
1073078009 10:100836624-100836646 TAATCCCGCACGGGGGCCGCGGG - Intergenic
1073262421 10:102200838-102200860 GGATCCCTCGCCGGGGCAGCGGG + Intergenic
1074098211 10:110331882-110331904 GGATCCCGCACTGGGGCCGCAGG - Intergenic
1074174981 10:110990179-110990201 GGATCCCGCACCAGGGCTGCAGG - Intronic
1074732537 10:116393768-116393790 GGATCTTGCACCGGGGCCGCAGG - Intergenic
1074996270 10:118760091-118760113 GGATCCAGCAAGAGGGCTGCAGG + Intergenic
1074999306 10:118783319-118783341 GCATCCCGCACCGGGGCTGCAGG - Intergenic
1075255700 10:120924241-120924263 GGATCCCGCAAAGGGGCTGCAGG - Intergenic
1075269307 10:121035283-121035305 GGATCCCACACTGGGGCTGCAGG + Intergenic
1075305783 10:121365946-121365968 GGATCCCGCACTGGGGCTGCAGG - Intergenic
1075307693 10:121382535-121382557 GGATCCCGCACTGGGGCTGCAGG - Intergenic
1075375945 10:121978334-121978356 GGATCCCGCACCAGGGTGGCTGG + Intergenic
1075537444 10:123283298-123283320 GGATCCCGCAAAGGGGCTGCAGG + Intergenic
1076261579 10:129071296-129071318 GGATCCCGCACCGGGGCTGCAGG + Intergenic
1076773689 10:132681070-132681092 GGATCCCGCACTGGGGCTGCAGG - Intronic
1076796459 10:132800889-132800911 GGATCCCGCACTGGGGCTGCAGG + Intergenic
1077190326 11:1253361-1253383 GGACCCTGCCCAGGGGCTTCTGG + Intronic
1077603304 11:3589096-3589118 GGATCCCGCACAAGAGCTGCAGG - Intergenic
1077764670 11:5144812-5144834 GGATCCCACACCGGGGCTGCAGG - Intergenic
1077778141 11:5294387-5294409 GGATCCCGCACCTGGGCTGCAGG + Intronic
1077805841 11:5590295-5590317 GGATCCCACACAGGGGCTGCAGG - Intronic
1078251826 11:9622979-9623001 GGATCCCGCACCGGGGCTGCAGG + Intergenic
1078301124 11:10133248-10133270 GGATCCCGCGTAGGGGCTGCAGG + Intronic
1078743616 11:14091271-14091293 GGATCCCGCACCGGGGCTGCAGG + Intronic
1078795898 11:14591481-14591503 GAATCCCACACTGGGGCTGCAGG - Intronic
1078891418 11:15561339-15561361 GGATACCGCACCGGGGCCGCAGG - Intergenic
1079109975 11:17599897-17599919 GGGCCCCGGACAGGGGCTGCAGG - Intronic
1079190909 11:18276080-18276102 GGATCCCGCACCGGGGCCACAGG + Intergenic
1079555349 11:21753086-21753108 GGATCCCGCACGGGGGCTGCAGG + Intergenic
1079708607 11:23653122-23653144 GGATCCCTTACCAGGGCTGCAGG + Intergenic
1079726146 11:23883375-23883397 GGATCCCGCACCAGGGCTGCAGG + Intergenic
1079754190 11:24235074-24235096 GGATCCCTAAGAGGGGCTGGTGG + Intergenic
1079867678 11:25756505-25756527 GGATCCCGCACCAGGGCCGCGGG - Intergenic
1080105952 11:28512277-28512299 GGATCCCGCACCGGGGCAGCAGG + Intergenic
1080107426 11:28525741-28525763 GGATCCCGCACCGGGGCCGCAGG + Intergenic
1080138903 11:28891033-28891055 GGATCCCGCACTGGGGCCGCAGG - Intergenic
1080195126 11:29600092-29600114 GGATCCTACACCGGGGCTGCAGG + Intergenic
1080557618 11:33431687-33431709 GGATCCCGCACCGGGGCTGCAGG + Intergenic
1080621523 11:33990515-33990537 GGATCCCGCACCGGGGCTGCAGG - Intergenic
1081115275 11:39192576-39192598 GGATCTTGCACTGGGGCTGCAGG + Intergenic
1081125136 11:39312248-39312270 GGATCCCGCACCGGGGCTGCAGG - Intergenic
1081126861 11:39333013-39333035 GGATCCTGCACCGGGGCCGCAGG + Intergenic
1081315269 11:41623253-41623275 GGATTCCGCACTGGGGCTGCAGG - Intergenic
1081324397 11:41728035-41728057 GGATCTTGCACCAGGGCTGCAGG + Intergenic
1081420974 11:42874329-42874351 GGATCCTGCACCAGGGCTGCAGG - Intergenic
1081422143 11:42881799-42881821 GGATCCCGCACTGGGGCTGCAGG - Intergenic
1081428461 11:42950302-42950324 GGATCCCGCACGAGGGCTGCAGG - Intergenic
1082270373 11:50163991-50164013 GGATCCCGTACTGGGGCTGCAGG + Intergenic
1082272194 11:50183690-50183712 GGATCCCGCCCTGGGGCTGCAGG - Intergenic
1082283708 11:50298478-50298500 GGAACTCGCGGAGGGGCTGCTGG - Intergenic
1082698684 11:56401864-56401886 GGATCCTGCACCGGGGCTGCAGG + Intergenic
1083074223 11:60020201-60020223 GGATCCCATACCGGGGCTGCAGG + Intergenic
1083448525 11:62727054-62727076 GGATCTGGCGCAGCGGCTGCAGG - Exonic
1083546185 11:63550620-63550642 GGATCCTGCACCGGGGCTGCAGG - Intergenic
1083869379 11:65477535-65477557 GGCACCCGCGCAGGGGCCGCTGG - Intergenic
1084024674 11:66440722-66440744 GGATCCCGCACCCGGGCTACAGG + Intronic
1084107487 11:66989209-66989231 GGATCCCGCACCGGGGCTGCAGG - Intergenic
1084186717 11:67476469-67476491 GGATCGCGCACCGTGGCTGCAGG - Intergenic
1084240628 11:67817601-67817623 GGATCCTGCACTGGGGCCACAGG + Intergenic
1084259199 11:67963639-67963661 GGATTCTGCACAGGAGCTGCAGG - Intergenic
1084499369 11:69525703-69525725 TGATGCCGCACAGAGGCTGAGGG - Intergenic
1084555989 11:69876128-69876150 GGATCCAGCCTGGGGGCTGCAGG + Intergenic
1084679891 11:70660823-70660845 GGGTCCCGCACCTGTGCTGCAGG - Intronic
1084831799 11:71775111-71775133 GGATCCTGCACTGGGGCCGCAGG - Intergenic
1085245679 11:75098624-75098646 GGGTCCCGCACCGGGGCTGCAGG - Intergenic
1085375963 11:76060981-76061003 AGATCCCGCACCAGGGCCGCAGG - Intronic
1085447179 11:76608973-76608995 GGATCCTGCACCAGGGCTGCAGG + Intergenic
1085671018 11:78464914-78464936 GGATCCCACACTGGGGCTGCAGG + Intronic
1085982718 11:81744460-81744482 GGATCCCCCACCAGGGCCGCAGG + Intergenic
1086043107 11:82501574-82501596 GGATCCCGCACCGGGTCTGCAGG - Intergenic
1086210044 11:84308494-84308516 GGATCCCGCACGGGGGCCACAGG + Intronic
1086397673 11:86433467-86433489 GGATCCCGCACCGGGGCCGCAGG + Intergenic
1086724703 11:90167558-90167580 GGATCCCACACCGGGGCCACAGG - Intronic
1086808095 11:91269172-91269194 GGATCCTGCACCGGGGCTGCAGG - Intergenic
1087354613 11:97077016-97077038 GGATCCCGCACCAGGGCTGCAGG - Intergenic
1087441111 11:98185159-98185181 GGATCCTGCGCTGGGGCTGCAGG + Intergenic
1087486312 11:98763352-98763374 GGATCCCGCACCGGGGCTGCAGG + Intergenic
1087683730 11:101241190-101241212 GGATCCCGCACCAGGGCCGCAGG + Intergenic
1087966491 11:104422374-104422396 GGATCTCGCACTGGGGCTGCAGG + Intergenic
1088570951 11:111222393-111222415 GGATCCCGCACCAGGGCTGCAGG - Intergenic
1088920723 11:114258205-114258227 GGATGCCGCCGTGGGGCTGCAGG + Intronic
1089062048 11:115633837-115633859 GGATCTCGCACTGGGGCTGCAGG + Intergenic
1089135263 11:116244147-116244169 GGATGGCGCAGAGGTGCTGCAGG - Intergenic
1089191768 11:116659030-116659052 GGAGCCCTCACAGGGGGTGGAGG - Intergenic
1089323985 11:117644764-117644786 GTCTACCGCACAGGGGCTGGGGG - Intronic
1089365137 11:117916984-117917006 GGATACCCCACAGGGGCCCCGGG + Intronic
1089373494 11:117978431-117978453 GGATCCCGCACCGGGGCTTCAGG + Intergenic
1089466328 11:118688920-118688942 GGATTCCGCACCCCGGCTGCAGG + Intergenic
1089800320 11:121022076-121022098 GGATCCCGCACCGGGGCTGCAGG - Intergenic
1090229303 11:125089913-125089935 GGATCCCGCACCGGGGCTGCAGG - Intronic
1090307606 11:125704646-125704668 GGATCCCGCACCGGGGCTGCAGG + Intergenic
1090776648 11:129971776-129971798 GGATCCCGCACCGGGGCTGCAGG + Intronic
1090848078 11:130546901-130546923 GGATCTCGCAGAGGGGCGGCTGG - Intergenic
1091174606 11:133546924-133546946 GGAGGCCGCACAGGGGCAGGAGG - Intergenic
1091201280 11:133782715-133782737 GGATCCCAAACCGGGGCCGCAGG - Intergenic
1091233373 11:134002832-134002854 GGATCCCGCACCGGGGCTGCAGG + Intergenic
1091402174 12:188061-188083 GGATCCCTCACTGGGGCCACAGG + Intergenic
1092101628 12:5888839-5888861 GGATCCCACACTGGGGCCGCAGG + Intronic
1092133997 12:6132897-6132919 GGGTCCCGCACTGGGGCCGCAGG - Intergenic
1092137504 12:6159891-6159913 GGATCCCGCACCTGGGCTGCAGG - Intergenic
1092142031 12:6190815-6190837 GGATCCCGCACCAGCGCTGCAGG + Intergenic
1092220362 12:6708698-6708720 GGATCCCACGCTGGGGCTGCAGG - Intergenic
1092221476 12:6716452-6716474 GGATCCCGCACCGAGACTGCAGG - Intergenic
1092272998 12:7037837-7037859 AGATCCCGCACCGGGGCTGCAGG - Intronic
1092364127 12:7862602-7862624 GGATCACGCACCGGTGCTGCAGG - Intronic
1092366626 12:7881692-7881714 GGATCTTGCACTGGGGCTGGAGG - Intronic
1092410858 12:8252135-8252157 GGGTCCCACATGGGGGCTGCAGG + Intergenic
1092430513 12:8404644-8404666 GGATCCCGCACAGGAGCCGCAGG - Intergenic
1092471847 12:8787682-8787704 GAATCCCGCACCGGGGCTGCAGG - Intergenic
1092473042 12:8795141-8795163 GAATCCCGCACCGGGGCTGCAGG - Intergenic
1092572346 12:9739514-9739536 GGATCCCACACCGGGGCTGCAGG + Intergenic
1092583760 12:9876115-9876137 GGATCCCGCACCTGGGCTGCAGG + Intergenic
1092617072 12:10225557-10225579 GGATCCCACACCGGGGCTGCAGG + Intergenic
1092732532 12:11547664-11547686 GGATCCCCCACCGGGGCTGCAGG - Intergenic
1092834148 12:12472378-12472400 GGATCCTGCACCAGAGCTGCAGG + Intergenic
1093034579 12:14320510-14320532 GGATCCCGCAATGGGGCTGCAGG - Intergenic
1093189480 12:16057791-16057813 GGATCCCGCACCAGGGCTGCAGG - Intergenic
1093266351 12:17008040-17008062 GGATCCCGCACTGGGGCTACAGG - Intergenic
1093346326 12:18040627-18040649 GGATCCTGCACCAGGGCCGCAGG - Intergenic
1093381637 12:18500561-18500583 GGATCTCGCATTGGGGCTGCAGG - Intronic
1093527016 12:20115174-20115196 GGATCCCGCACCGGGGCTGCAGG + Intergenic
1093580959 12:20783724-20783746 GGATCTTGCACTGGGGTTGCAGG + Intergenic
1093653831 12:21673951-21673973 GGATCCCGCACCTGGGCAGCAGG + Intronic
1093793797 12:23286344-23286366 GGATCCCGCACCGGGGCTGCAGG - Intergenic
1093970282 12:25369782-25369804 GGATCCCGCACAGGGGCTGCAGG - Intergenic
1094338525 12:29386185-29386207 GGATCCCGCACCTGGGCTGCAGG + Intergenic
1094405286 12:30110426-30110448 GGATCCCGCACTGGGGCCACAGG + Intergenic
1094409913 12:30157276-30157298 GGATCCCGCACCAGGGCTGCAGG - Intergenic
1094448801 12:30562049-30562071 GGATCCCGCACCCGGGCTGCAGG - Intergenic
1094589225 12:31805733-31805755 GGATCCCGCACCGTGGCTGCAGG + Intergenic
1094661360 12:32472708-32472730 GGATCCCGCACCGGGGCTGCAGG - Intronic
1094666561 12:32526088-32526110 GGATCCCGCACCGGGGCTGCAGG - Intronic
1094718120 12:33033875-33033897 GGATCCCGCACCGGGGCTGCAGG + Intergenic
1094819171 12:34211411-34211433 GGGCCCAGCGCAGGGGCTGCTGG + Intergenic
1094827841 12:34286506-34286528 GGGCCCCACACAGTGGCTGCTGG - Intergenic
1094828390 12:34288808-34288830 GGATCCCACGCAAGGGCTGCTGG - Intergenic
1094828489 12:34289201-34289223 GGATCCCACGCTGGGGCTTCTGG - Intergenic
1094828567 12:34289507-34289529 GGACCCCACACAGGGGCTGCTGG + Intergenic
1094828945 12:34291091-34291113 GGAACCCACGCAGGGGCTGCTGG + Intergenic
1094828998 12:34291302-34291324 GGACCCTGTGCAGGGGCTGCTGG + Intergenic
1094829090 12:34291708-34291730 GGACCCCACGCAAGGGCTGCTGG + Intergenic
1094829355 12:34292875-34292897 GGGCCCTGCACAGGGGCTGCTGG + Intergenic
1094829440 12:34293260-34293282 GGGCCCCACGCAGGGGCTGCTGG + Intergenic
1094829607 12:34294067-34294089 GGATCCCACACAGGGGCAGCTGG + Intergenic
1094829657 12:34294279-34294301 GAACCCCACGCAGGGGCTGCTGG + Intergenic
1094829853 12:34295104-34295126 GGATCCCACGCAGGGGTTACTGG + Intergenic
1094829973 12:34295672-34295694 GGGCCACCCACAGGGGCTGCCGG - Intergenic
1094830064 12:34296076-34296098 GGACCCCACACTTGGGCTGCTGG - Intergenic
1094830162 12:34296485-34296507 GGATCCCGTGCAAGGGCTGCTGG - Intergenic
1094830204 12:34296677-34296699 GGACCCCATGCAGGGGCTGCTGG - Intergenic
1094830421 12:34297660-34297682 GGACCCCACACCAGGGCTGCTGG - Intergenic
1094830555 12:34298258-34298280 GGATGCCACACAGAGGCTGCTGG - Intergenic
1094830652 12:34298661-34298683 GGTCCCCACGCAGGGGCTGCTGG - Intergenic
1094830934 12:34299938-34299960 AGACCCCACGCAGGGGCTGCTGG - Intergenic
1094831023 12:34300342-34300364 GGGCCCTGCGCAGGGGCTGCTGG - Intergenic
1094831164 12:34300970-34300992 GGGACCTGCACAGGGACTGCTGG - Intergenic
1094831552 12:34302586-34302608 GGGCACCGCACAGTGGCTGCTGG - Intergenic
1094832030 12:34304704-34304726 GGGCCTGGCACAGGGGCTGCGGG - Intergenic
1094832312 12:34305997-34306019 GGGCCCACCACAGGGGCTGCTGG - Intergenic
1094832363 12:34306206-34306228 TGTCCCCGCGCAGGGGCTGCTGG - Intergenic
1094832457 12:34306625-34306647 GGGCCCCGCGCAGGGGCTGCTGG - Intergenic
1094832560 12:34307047-34307069 GGTCCCCACACTGGGGCTGCTGG - Intergenic
1094832833 12:34308296-34308318 GGACCCCGCACAGGGACTGCTGG - Intergenic
1094832889 12:34308509-34308531 GGGCCCAGCACAGGGGCTACTGG - Intergenic
1094832943 12:34308719-34308741 GGTACCCGCGCAGGGTCTGCTGG - Intergenic
1094833266 12:34310109-34310131 GGATCCTGCACAGGGGCTGCAGG - Intergenic
1094833938 12:34313507-34313529 GGACCCCGCACAGGGGCTACTGG + Intergenic
1094834094 12:34314161-34314183 GGGACCCGCGCAGGGGATGCTGG + Intergenic
1094834801 12:34317298-34317320 GGGCCCCGCACAGGGGCTACTGG + Intergenic
1094834850 12:34317508-34317530 GGACTCTGCACAGGGGCTGCTGG + Intergenic
1094835993 12:34322346-34322368 GGGTCCCCCGCAGGGGCTGCTGG + Intergenic
1094836046 12:34322555-34322577 GGGCCCTGCGCAGGGGCTGCTGG + Intergenic
1094836373 12:34324033-34324055 GGGCCCAACACAGGGGCTGCTGG + Intergenic
1094836466 12:34324433-34324455 AGACCCCACTCAGGGGCTGCTGG + Intergenic
1094836975 12:34326639-34326661 GGACCCCGCGCAGGGGATGCTGG + Intergenic
1094837023 12:34326851-34326873 GGACACAGCGCAGGGGCTGCTGG + Intergenic
1094837148 12:34327459-34327481 GGGCCCAGCGCAGGGGCTGCTGG + Intergenic
1094837385 12:34328497-34328519 GGGCCGTGCACAGGGGCTGCTGG + Intergenic
1094837907 12:34330806-34330828 GGTCTCCGCGCAGGGGCTGCTGG + Intergenic
1094841006 12:34342705-34342727 GGACCCCGCACATGAGCAGCAGG - Intergenic
1094842364 12:34347486-34347508 GAATCCCGCGCATGGGCAGCAGG + Intergenic
1095096451 12:38151993-38152015 GGACCGAACACAGGGGCTGCCGG - Intergenic
1095096501 12:38152196-38152218 GGTTCCAGCGCAGAGGCTGCTGG - Intergenic
1095096644 12:38152777-38152799 GGTTCTGGCACAGAGGCTGCTGG - Intergenic
1095097323 12:38155609-38155631 GGGCCCGGCGCAGGGGCTGCAGG - Intergenic
1095098192 12:38159007-38159029 GGGTCCCACTCAGAGGCTGCCGG - Intergenic
1095123166 12:38442365-38442387 GGATCCCACACCAGGGCTGCAGG - Intergenic
1095304212 12:40621028-40621050 GGATCCCTCACCGGGGCTGCAGG - Intergenic
1095478573 12:42610891-42610913 GGATCCTGCACCAGGGCCGCAGG + Intergenic
1095534036 12:43224696-43224718 GGATGCCACACTGGGGCTGCAGG - Intergenic
1095776777 12:46018433-46018455 GGATCCCGCACGGGGGCTGCAGG - Intergenic
1097017845 12:56000089-56000111 GGATCCCGCACTGGTGCTGCAGG + Intronic
1097128863 12:56795783-56795805 GGATCCCGCACCGGGGCTGCAGG + Intergenic
1097213002 12:57386685-57386707 GGATCCTGCACTGGGGCTGCAGG - Intronic
1097664125 12:62461219-62461241 GGATCTCGCACCAGGGCCGCAGG + Intergenic
1098168141 12:67719176-67719198 GGATCCCGCACAGGGGCTGCAGG + Intergenic
1098498680 12:71166144-71166166 GGATCCCACACCGGAGCCGCAGG + Intronic
1098588752 12:72185462-72185484 GGATCCCGCACAGGGGCTGCAGG - Intronic
1098759318 12:74403364-74403386 GGATCCCACACCGGGGCTGCAGG - Intergenic
1099191038 12:79561964-79561986 GGATCCCGCACCAGGGCCACGGG - Intergenic
1099191471 12:79565370-79565392 GGATCCCACACCGGGGCCACAGG - Intergenic
1099192502 12:79574288-79574310 GGATCTCGCACTGGGGCCACAGG - Intergenic
1099228081 12:79993166-79993188 GGATCCTGCACAGGGGTCACAGG + Intergenic
1099413637 12:82361359-82361381 GGATCCCACGTTGGGGCTGCAGG + Intronic
1099443895 12:82729139-82729161 GGATCCCGCACTGGGGCCACAGG - Intronic
1099523868 12:83696239-83696261 GGATCCCTCACTGGGGCTGCAGG + Intergenic
1099559548 12:84155067-84155089 GGATCCTGCACCAGGGCTGCAGG + Intergenic
1099716157 12:86296346-86296368 GGATCCCACACCAGGGCTGCAGG + Intronic
1100166545 12:91923852-91923874 GGATCCCACACCGGGGTTGCAGG + Intergenic
1100211811 12:92406483-92406505 GGATCCCGCACCGGGGCTGCAGG + Intergenic
1100521530 12:95380001-95380023 GGATCCCGCACCGGGGCTGCAGG - Intronic
1100584769 12:95969550-95969572 GGATCCCGCACCGGGGCTGCAGG - Intergenic
1100600712 12:96109278-96109300 GGATCCCGCACCGGGGCTGCAGG - Intergenic
1100734558 12:97512729-97512751 GGATCCCGCACCGGGGCTGCAGG + Intergenic
1101009069 12:100430718-100430740 GGATCCCGCACCGGGGCTGCAGG - Intergenic
1101021698 12:100559798-100559820 GGATCCGGCACCAGGGCTGCAGG - Intronic
1101399198 12:104373325-104373347 CCATCCTTCACAGGGGCTGCTGG - Intergenic
1101461889 12:104905456-104905478 GGATCCCGCACCGGGGCTGCAGG + Intronic
1102309837 12:111836069-111836091 GGATCCTGCACCCGGGCCGCAGG - Intergenic
1102387178 12:112519876-112519898 AGATCCTGCACCAGGGCTGCAGG + Intergenic
1103146071 12:118597120-118597142 GGATCCCGCACCAGGGCTGCAGG + Intergenic
1103209569 12:119156677-119156699 GGAGCCCGGACTAGGGCTGCGGG - Exonic
1103439144 12:120950270-120950292 GGATCTCCCACTGGGGCTGCAGG + Intergenic
1103459591 12:121093479-121093501 GGATTCCGCACGAGGGCCGCAGG + Intergenic
1103497629 12:121374855-121374877 GGATCCCGCACAGGAGCTGCAGG - Intronic
1103853363 12:123947377-123947399 GGATCCCACACCGGGGCTGCAGG - Intronic
1104344573 12:127983801-127983823 GGATCCCGCACCAGGGCCGCAGG - Intergenic
1104582716 12:130022471-130022493 GGATCCCGCACCGGGGCTGCAGG - Intergenic
1104614441 12:130256598-130256620 GGATCCCGCACTGGGGTTGCAGG + Intergenic
1104749318 12:131228228-131228250 GGATCCCGCACCGGGGCTGCAGG - Intergenic
1105037827 12:132939170-132939192 GGATCCCGCACCGGGGCTGCAGG - Intronic
1105277309 13:18943637-18943659 GGGCCCCACGCAGGGGCTGCAGG + Intergenic
1105426822 13:20301719-20301741 GGGACCCGCGGAGGGGCTGCTGG - Intergenic
1105477321 13:20739875-20739897 GGATCCAGCACTGGGGCCACAGG + Intronic
1105605094 13:21920646-21920668 GGATACCGCACTGGGGCAGCAGG + Intergenic
1105722245 13:23127987-23128009 GGATCCCGCACTGGGGCTGCAGG - Intergenic
1105777568 13:23677783-23677805 GGATCTCGCACGGGGGCTGCAGG + Intergenic
1105876610 13:24560650-24560672 GGATCCTGCACCAGGGCTGCAGG + Intergenic
1106221248 13:27748257-27748279 GGATCCCGCGCCGGGGCTGCAGG + Intergenic
1106600484 13:31182996-31183018 GGATCCCTCACCAGGGCTGCAGG + Intergenic
1106616990 13:31339609-31339631 GGATCCCACACTGGGGCTGCAGG + Intergenic
1106643357 13:31608773-31608795 GGATCCCGCACCAGGGCTGCAGG + Intergenic
1106811023 13:33358397-33358419 GGATCCCACACCGGGGCTGCAGG - Intergenic
1107259308 13:38472374-38472396 GGATCCCGCACTGGGGCTGCAGG + Intergenic
1107590388 13:41898523-41898545 GGATCCCGCACCAGGGCTGCAGG + Intronic
1107836192 13:44413991-44414013 GGATCCCGCACCGAGGCTGCAGG - Intergenic
1108099106 13:46935999-46936021 GGATCCCACACCAGGGCTGCAGG + Intergenic
1108362237 13:49678277-49678299 GGATCCCGCACCAGGGCCGTGGG + Intronic
1108435420 13:50397005-50397027 GGATCCTGCACTGGGGCTGCAGG - Intronic
1108469383 13:50753251-50753273 GGATCCCGCACCAGGGCTGCAGG + Intronic
1108686808 13:52826672-52826694 GGATCCCGCACCAGGGCTGTGGG - Intergenic
1108750190 13:53440064-53440086 GGATCCTGCACAGGGGCCATGGG - Intergenic
1108751463 13:53452338-53452360 GGATCCCGCACCAGGGCTACAGG + Intergenic
1108851541 13:54737220-54737242 GGATCCCGCACTGGGGCTGCAGG + Intergenic
1108991067 13:56659054-56659076 GGATCCCACACTGGGGCCGTGGG + Intergenic
1108996076 13:56735979-56736001 GGATCCCGCACAGGGGCTGCAGG - Intergenic
1109007833 13:56901146-56901168 GGTTCTGGCACTGGGGCTGCAGG - Intergenic
1109124644 13:58504215-58504237 GGATCCCGCACCAGGGCTGCAGG + Intergenic
1109141122 13:58714499-58714521 GGATCCCGCACCGGGGCTGCAGG - Intergenic
1109152041 13:58858800-58858822 GGATCCTGCACAAGGGCCCCAGG + Intergenic
1109159799 13:58958126-58958148 GGATCCCGTACCGGGGCTGCAGG + Intergenic
1109364707 13:61339576-61339598 GGATCCCTCACTGGGGCTGCAGG - Intergenic
1109441440 13:62379645-62379667 GGATCCCGCACCGGGGCTGCAGG - Intergenic
1109506220 13:63306148-63306170 GGATCTGGCACAGGGGCCGCAGG - Intergenic
1109563094 13:64077479-64077501 GGATCCTGCACCGGGGCTGCAGG + Intergenic
1109745891 13:66622365-66622387 GGCTCCTGCACCGGGGCTGCAGG - Intronic
1109854221 13:68107663-68107685 GGATCCTGCACTGGGGCCACAGG + Intergenic
1110023996 13:70511855-70511877 GGATCCCGCACCAGAGCTGCAGG + Intergenic
1110064606 13:71087660-71087682 GGATCCCGCACCAGGGCTTCGGG - Intergenic
1110368948 13:74718804-74718826 GGATCCCGCACCGGGGCTGCAGG - Intergenic
1110417552 13:75268865-75268887 GGATCCCATACTGGGGCTGCAGG - Intergenic
1110792329 13:79600102-79600124 AGATCCCGCACTGGGGCTGCAGG + Intergenic
1110854122 13:80278597-80278619 GGATACCCCACTGGGGCCGCAGG + Intergenic
1110862211 13:80355953-80355975 GGATCCCACACCGGGCCTGCAGG - Intergenic
1110874287 13:80490501-80490523 GGATCCCGCACTGGGGCTGCAGG + Intergenic
1110940217 13:81340715-81340737 GGATCCCGCACCGGGGCTACCGG + Intergenic
1110999768 13:82164891-82164913 GGATCTCACACTGGGGCTGCAGG + Intergenic
1111006718 13:82258375-82258397 GGATCTCGCACCGGGGCCACAGG - Intergenic
1111220994 13:85205341-85205363 GGATCCCGCTCCGGGGCTGTGGG - Intergenic
1111441978 13:88292236-88292258 GGATCCTGCACTGGGGCTGCAGG - Intergenic
1111556100 13:89883810-89883832 GGATCCCGCACCAGCCCTGCAGG + Intergenic
1111591105 13:90349015-90349037 GGATCCCGCATGGGGGCTGCAGG - Intergenic
1111602795 13:90495188-90495210 CGATACCCCACTGGGGCTGCAGG - Intergenic
1111748401 13:92297082-92297104 GGATCCCGCACAGGGGCTGCAGG - Intronic
1111841336 13:93454730-93454752 GGATCCCGCACCCGGGCTGCAGG + Intronic
1112077671 13:95931381-95931403 GGATCCCACACCTGGGCCGCAGG + Intronic
1112226584 13:97545701-97545723 GGATCCCACATGGGGGCCGCAGG - Intergenic
1112282625 13:98076279-98076301 GGATCCTGCACCCGGGCCGCAGG + Intergenic
1112518719 13:100077932-100077954 GGATCCCACACCAGGGCTGCAGG - Intergenic
1112533093 13:100223993-100224015 GGATCCCGCACCGGGGCTGCAGG + Intronic
1112613176 13:100976112-100976134 GGATCCCGCACCGGGGCTGCAGG - Intergenic
1112702752 13:102030703-102030725 GAGTCCCGCACAGGGACTTCGGG + Intronic
1112705927 13:102068890-102068912 GGATCCTGCACTGGGGCTGCAGG - Intronic
1112842761 13:103600355-103600377 GGATCCCGCACCAGGGCTGCAGG - Intergenic
1113371877 13:109732613-109732635 GGATCCCGCCCGGGGGCTGCAGG + Intergenic
1113482610 13:110632973-110632995 GGATCCCGCACCAGGGCTGCAGG + Intronic
1113506708 13:110821576-110821598 GGATCCCACACCGAGGCTGCAGG - Intergenic
1113538056 13:111083816-111083838 GGGTCCCGCACCGGGGCTGCAGG + Intergenic
1113678127 13:112222133-112222155 GGATCCCACACCGAGGCTGCAGG - Intergenic
1114086894 14:19241229-19241251 GGACCTAGCGCAGGGGCTGCTGG + Intergenic
1114560237 14:23584825-23584847 GGATCCTGCACCGGGGCTGCAGG + Intergenic
1114593613 14:23892174-23892196 GGATCCCCCACCAGGGCTGCAGG - Intergenic
1114957843 14:27845790-27845812 GGATCCCGCGCTGGGGCCGCTGG - Intergenic
1115174513 14:30547452-30547474 GGATCCCGCCCCAGGGCTGAAGG + Intergenic
1115533173 14:34345750-34345772 GGATCCCGCACCAGGGCCACAGG + Intronic
1116152045 14:41154193-41154215 GGATCCCGCGGTAGGGCTGCGGG + Intergenic
1116223118 14:42113437-42113459 GGATCCTGCACCGGGGCTGTAGG + Intergenic
1116250958 14:42482329-42482351 GGATCCGGCACCGGGGCTGCAGG + Intergenic
1116311080 14:43327019-43327041 GGATCCTGCACAGGGGCCGCAGG - Intergenic
1116452437 14:45080852-45080874 GGATCCCGCTCTGGGGCTGCAGG - Intergenic
1116624089 14:47242860-47242882 GGATCCCACACCGGGGCTGCAGG - Intronic
1117077943 14:52122661-52122683 GGATCCCGCACCAGGGCTGCAGG - Intergenic
1117302591 14:54443468-54443490 ATATCCCACACCGGGGCTGCAGG - Intergenic
1117565704 14:56991433-56991455 GGATCCTGCACCAGGGCTGCGGG - Intergenic
1117571852 14:57056560-57056582 GGATCCCGCACCGGGGCTGCAGG + Intergenic
1118215296 14:63803208-63803230 GGATCCCCCACCGGGGCTGCAGG + Intergenic
1118306385 14:64658544-64658566 GGATACCGCACAGGGGCTACAGG - Intergenic
1118932495 14:70255259-70255281 GGATCCCGCACAGGGGCCGCAGG - Intergenic
1119027846 14:71167909-71167931 GGATCCCGCACTGGGGCCGCAGG - Intergenic
1119089197 14:71764846-71764868 AGATCCCTCACAGGTGCTGGGGG + Intergenic
1119300248 14:73566277-73566299 GGATCGTGCACTGGGGCTGCAGG + Intergenic
1119401693 14:74367014-74367036 GTATCCAGGACAGGGGCTGATGG + Intergenic
1119486855 14:74994565-74994587 GGATCCCGCACTGGGGCTGCAGG - Intergenic
1119673369 14:76536694-76536716 GGATCCCGCACCGGGGCTGCAGG + Intergenic
1119870633 14:78013924-78013946 GGATCCTGCAACAGGGCTGCAGG + Intergenic
1120331053 14:83092797-83092819 GGATCCCGCACCGGTGCTGTAGG - Intergenic
1120429681 14:84399331-84399353 GGATCCTGCACTGGGGCTGCAGG + Intergenic
1120439033 14:84512852-84512874 GGATCCCACACCGGGGCTGCGGG + Intergenic
1120704681 14:87734674-87734696 GGATCTCGCACCAGGGCCGCAGG + Intergenic
1120844233 14:89112064-89112086 GGATTCTGCACGGGGGCTGCAGG - Intergenic
1122216453 14:100208110-100208132 GGCTCCTGCACTGGGGCTGGAGG + Intergenic
1122493383 14:102135455-102135477 GGATCCCGCACCGGGGCTGCAGG + Intronic
1122514611 14:102298105-102298127 GGATCCCACACCAGGGCTGCAGG - Intronic
1122894750 14:104751468-104751490 GGATCCCACACCGGGGCTGCAGG + Intergenic
1123120722 14:105915186-105915208 GGCCCCTGCACAGGTGCTGCTGG + Intergenic
1202899323 14_GL000194v1_random:26478-26500 GGGCCCAGCACAGGGGCTGATGG + Intergenic
1202899522 14_GL000194v1_random:27330-27352 GTACCCAGCACAGGGGCTGATGG + Intergenic
1123771762 15:23536366-23536388 GGAACCCTCAGAGGAGCTGCTGG - Intergenic
1123949057 15:25253137-25253159 GGATCCCGCACTGGGGCTGCAGG + Intergenic
1124028618 15:25989539-25989561 GTAGCCCGCTTAGGGGCTGCAGG + Intergenic
1124036430 15:26057289-26057311 GGATCCTGCACTGGGGCCGCAGG - Intergenic
1124207214 15:27731848-27731870 GGAACCCACACTGGGGATGCTGG - Intergenic
1124485556 15:30111923-30111945 GCATCCAGCCCACGGGCTGCGGG + Intergenic
1124518020 15:30385344-30385366 GCATCCAGCCCACGGGCTGCGGG - Intronic
1124540633 15:30580909-30580931 GCATCCAGCCCACGGGCTGCGGG + Intergenic
1124573203 15:30884173-30884195 GGATCCCGCACCGGGGCTGCAGG - Intergenic
1124758022 15:32426673-32426695 GCATCCAGCCCACGGGCTGCGGG - Intergenic
1124818402 15:33019430-33019452 GGATCCTGCACCGGGGCCGCAGG + Intronic
1125112291 15:36047369-36047391 GGATCCCGCACCGGGGCTGCAGG - Intergenic
1125480216 15:40074717-40074739 GGATCCCGCAATGGGGCTGCAGG + Intergenic
1125565680 15:40676871-40676893 GGATCCGGCCCAGGGGCTGCAGG + Intergenic
1125609774 15:40962035-40962057 GGATCCCGCACCGGGGCTGCAGG - Intergenic
1125885477 15:43226532-43226554 GGATCCCGCACTGGGGCCGCAGG + Intergenic
1125914482 15:43473816-43473838 GGATCTCGCACGGGGGCTGCAGG + Intronic
1126089066 15:45035251-45035273 GGATCTCGCACTGGGGCTGCAGG - Intronic
1126128159 15:45314514-45314536 GGATCCCGCATGGGGGCTGCAGG - Intergenic
1126567258 15:50113197-50113219 GGGGCCAGCACTGGGGCTGCAGG - Intronic
1126639747 15:50812385-50812407 GGATCCCGCATCGGGGCCACAGG - Intergenic
1127211670 15:56780063-56780085 GGATCTCCCATCGGGGCTGCAGG - Intronic
1127765992 15:62186508-62186530 GGATCCTGCACCAGGGCTGCAGG + Intergenic
1127916511 15:63459463-63459485 GGATCCTGCACCGGGGCCGCAGG - Intergenic
1127984858 15:64061302-64061324 GGATCCCCCACCAGGGCCGCAGG - Intronic
1128110916 15:65075441-65075463 GGATCCTGCACCAGGGCTGCAGG - Intronic
1128140979 15:65301010-65301032 GGATCCTCCACTGGGGCCGCAGG + Intergenic
1128543329 15:68551629-68551651 GGGTCCCTCACAGGGGCTCTGGG - Intergenic
1128598495 15:68975613-68975635 GGACCCCGCACCGGGGCTGCAGG + Intronic
1128669910 15:69567302-69567324 GGATCCCGCACCAGGGCTGCAGG + Intergenic
1128813233 15:70587118-70587140 GGATCCCGCACCAGGGCTGCAGG + Intergenic
1129158190 15:73732129-73732151 GGATCCCCCACCGGGACTACAGG + Intergenic
1129196996 15:73974125-73974147 GGATCCCACACGGGGGCTGCAGG - Intergenic
1129208706 15:74052916-74052938 GGATCCCGCACGGGGGCCGCAGG - Intergenic
1129373940 15:75115940-75115962 GGATCCTGCACCGGGGCTGCAGG + Intronic
1129777428 15:78246081-78246103 GGATCCCGCACCCGGGCTGCAGG + Intergenic
1129859243 15:78847290-78847312 GGATCCCGCACGGGGGCTGCAGG - Intronic
1129997217 15:80016894-80016916 GGATCCCGCACTGGGGCTGCAGG - Intergenic
1130132941 15:81159038-81159060 GGATCCCGCACCGGGGCTGCAGG - Intergenic
1130954993 15:88621393-88621415 GGACCCTGCACCGGGGCGGCGGG + Intronic
1131012630 15:89031643-89031665 GGATCCCGCACCGGGGCCGCAGG + Intergenic
1131472765 15:92711029-92711051 GGATCCCACACCGGGGAGGCAGG + Intronic
1131507860 15:93032244-93032266 GGATCCCGCACCGGGGCTGCAGG - Intergenic
1131846036 15:96491776-96491798 GGATCCCGCACCGGGGCTGCAGG + Intergenic
1131892113 15:96984118-96984140 GGATACTGCACAGGGGCCGCAGG + Intergenic
1131912671 15:97224663-97224685 GGATTCCGCGCCGGGGCCGCGGG - Intergenic
1131992314 15:98104209-98104231 GGATCCTGCACCGGGGCGGCAGG + Intergenic
1132044277 15:98550129-98550151 GGATCCTGCACGGAGGCCGCAGG - Intergenic
1132097772 15:99000420-99000442 GGATCCCGCACTGGGGCCGTAGG - Intronic
1132098803 15:99008220-99008242 GGATCCCGCACCAGGGCCGCAGG + Intergenic
1132511090 16:341660-341682 GGATCCCGCACCGGGGTTGCAGG - Intronic
1132555859 16:572392-572414 GCAGCCCGCACTGGGGCTGGAGG - Intronic
1132618192 16:852598-852620 GGACCCCGTAGTGGGGCTGCAGG - Intergenic
1132733151 16:1372826-1372848 GCACACCGCACAGGGACTGCCGG + Intronic
1132733226 16:1373264-1373286 GCACACCGCACAGGGACTGCCGG + Intronic
1132733268 16:1373484-1373506 GCACACCGCACAGGGACTGCCGG + Intronic
1132733277 16:1373539-1373561 GCACACCGCACAGGGACTGCCGG + Intronic
1132733286 16:1373594-1373616 GCACACCGCACAGGGACTGCCGG + Intronic
1132733295 16:1373649-1373671 GCACACCGCACAGGGACTGCCGG + Intronic
1132733304 16:1373704-1373726 GCACACCGCACAGGGACTGCCGG + Intronic
1132733315 16:1373759-1373781 GCACACCGCACAGGGACTGCCGG + Intronic
1132733342 16:1373924-1373946 GCACACCGCACAGGGACTGCCGG + Intronic
1132733351 16:1373979-1374001 GCACACCGCACAGGGACTGCCGG + Intronic
1132733360 16:1374034-1374056 GCACACCGCACAGGGACTGCCGG + Intronic
1132836741 16:1958144-1958166 GGATCCCGCACGGGGGCTGCAGG + Intergenic
1133352092 16:5108495-5108517 GGATCCCGCCCTGGGGCCACAGG + Intergenic
1133362583 16:5186308-5186330 GGATCCCGCACCGGGGCTGCAGG + Intergenic
1133367460 16:5221954-5221976 GGATTCTGCACCGGGGCCGCAGG + Intergenic
1134678072 16:16104612-16104634 GGATGCCACACTGGGGCTGCAGG + Intronic
1135262049 16:20989586-20989608 GGATCCCGCACCGGGGCTGCAGG + Intronic
1135280933 16:21153014-21153036 GGCTCCTGCACCGGGGCTGCAGG - Intronic
1135299320 16:21312724-21312746 GGATCCCGCACCAGGGCTGCAGG + Intergenic
1135942626 16:26836043-26836065 GGATCCTGCACCAGGGCCGCAGG + Intergenic
1136163371 16:28435785-28435807 GGATCCCGCACCGGGGCTGCAGG - Intergenic
1136199592 16:28679202-28679224 GGATCCCGCACCGGGGCTGCAGG + Intergenic
1136215938 16:28793375-28793397 GGATCCCGCACCGGGGCTGCAGG + Intergenic
1136517202 16:30775308-30775330 GGATCCCGGACTGGGCCTGAAGG + Exonic
1137300505 16:47143915-47143937 GGATCCCGCGCCGGGGCCGCGGG - Exonic
1137442586 16:48509104-48509126 GGATCCCGCACCGGGGCCGCAGG - Intergenic
1137705221 16:50530872-50530894 TGATCCAGCACAGGGCCTGCTGG - Intergenic
1138688863 16:58749273-58749295 GGATCCCGCACCACGGCCGCAGG - Intergenic
1138693528 16:58790713-58790735 GGATCCCACACCGGGGCTGCAGG + Intergenic
1138889797 16:61128704-61128726 GGATCCCATGCTGGGGCTGCGGG + Intergenic
1139051553 16:63130049-63130071 GGATCCCGCAGGGGGACTGCAGG - Intergenic
1139147811 16:64344309-64344331 GGATCTCGCATTGGGGCTGCAGG - Intergenic
1139442379 16:66974645-66974667 GGATCCAGCACTGGGGCAGCAGG - Exonic
1139591332 16:67934924-67934946 GGAGGCTGCTCAGGGGCTGCTGG - Exonic
1139592292 16:67940029-67940051 GTATCCCGTGCAGGGGCAGCAGG + Exonic
1139600357 16:67982639-67982661 GGATGCTGCACCGGGGCCGCAGG - Intergenic
1139603130 16:67998632-67998654 GGATCCCGCACCAGGGATGCAGG - Intronic
1140722445 16:77784328-77784350 GGATCCCGCATGGGGGCTGCAGG + Intergenic
1141465668 16:84204559-84204581 GGATCCCGCACCGGGGCTGCAGG + Intergenic
1141700798 16:85641154-85641176 GAAACGGGCACAGGGGCTGCAGG - Intronic
1141837757 16:86553771-86553793 AGATCCCGCACTGGGGCTGCAGG - Intronic
1142133576 16:88441765-88441787 AGATCCCGCCCAGGTTCTGCTGG - Intergenic
1142371895 16:89687073-89687095 GGATCCAGCTCGGGCGCTGCTGG + Intronic
1142505741 17:362010-362032 GGATCCCGCACCGGGGCTGCAGG - Intronic
1143135202 17:4709040-4709062 GGATCCCGCTTGGGGGCCGCAGG + Intergenic
1143460443 17:7100536-7100558 GGATCCTGCACTGGGGCCGCAGG + Intergenic
1143708578 17:8718021-8718043 GGATCCCGCACTGGGGCCACAGG + Intergenic
1144467222 17:15506105-15506127 GGATCCCGCACCGGGGCTGCAGG - Intronic
1144586317 17:16489966-16489988 GGATCCCACAGTGGGGCTGCAGG + Intronic
1144723280 17:17486769-17486791 GGATCCCGCACCGGGGCTGCAGG - Intronic
1145050223 17:19654256-19654278 GGATCCCACGCCGGGGCTGTGGG + Intronic
1146740385 17:35278857-35278879 GGATCCCCCACCAGGGCAGCAGG + Intergenic
1147373697 17:40011351-40011373 GGATTCCGCACCAGGGCTGCAGG - Intergenic
1147431888 17:40376246-40376268 GGATCCCGCACCAGGGCTGCAGG - Intergenic
1147689015 17:42304220-42304242 GGATACGGGGCAGGGGCTGCTGG + Intronic
1147997607 17:44369220-44369242 GGATCCCGCACAGGGGCTGCAGG - Intergenic
1148016949 17:44528390-44528412 GGATCCTGCACCGGGGCTGCAGG - Intergenic
1148023444 17:44568601-44568623 GGATCCCGCATCGGGGCCACAGG - Intergenic
1148366106 17:47057228-47057250 GGATCCCGCACTGGGGCGGCAGG + Intergenic
1148460761 17:47837927-47837949 CGAGGCCACACAGGGGCTGCTGG - Exonic
1149099187 17:52883919-52883941 GGATGCCGCACCAGGGCCGCAGG + Intronic
1149916478 17:60614055-60614077 GGATCCCGCACCGGGGCCGCAGG - Intronic
1150778354 17:68099697-68099719 GGATCCCCCACCGGGGCTGCAGG - Intergenic
1150786687 17:68169302-68169324 GGATCCTGCACCGGGGTTGCAGG + Intergenic
1150792307 17:68208230-68208252 GGATCCCGCACTGGGGCCGCAGG - Intergenic
1150804535 17:68308856-68308878 GGATCCCGCACCGGCGCTGCAGG + Intronic
1151567392 17:74906987-74907009 GGATCCTGCACCGGGGCCGCAGG + Intergenic
1151782598 17:76257591-76257613 GGATCCCGCACTGGGGCTGCAGG + Intergenic
1151912791 17:77095036-77095058 GGCTTCCCCACAGGGGCTGGGGG + Intronic
1151966518 17:77434357-77434379 GGCGTCCGCACAGGGTCTGCTGG + Intronic
1152209473 17:78995367-78995389 GGCTCCCGCCCAGGGCCGGCCGG + Intronic
1152260121 17:79262296-79262318 GGGCCCCGGACAGGGGCTGTGGG + Intronic
1152419718 17:80185870-80185892 GGACCCTGCACAGGGGGTGCTGG + Intronic
1152430962 17:80248137-80248159 AGGTCACGCACAGGGGCAGCAGG - Exonic
1152618970 17:81351977-81351999 GGATCTCGCACTGGGGCTGCAGG + Intergenic
1203162388 17_GL000205v2_random:63653-63675 CGGTCCAGCACAGGGGCTGATGG + Intergenic
1153070460 18:1098648-1098670 GGATCCCGCACAGGGGCCACAGG - Intergenic
1153643980 18:7178610-7178632 GGATCCCCCACCGGGGCCACAGG + Intergenic
1153832388 18:8935367-8935389 GGATCCCGCACCAGGGCTGCAGG + Intergenic
1154057164 18:11023593-11023615 GGATCCCGCACCGGGGCGGCAGG + Intronic
1154128687 18:11716890-11716912 GGATCCCGCACGGGGGCTGCAGG + Intronic
1154231082 18:12557090-12557112 GGATCCCGCGTTGGGGCTGCGGG + Intronic
1154231354 18:12559025-12559047 GGATCCTGCACCAGGGCGGCGGG + Intronic
1154255235 18:12776790-12776812 GGATCCCGCATCAGGGCCGCTGG + Intergenic
1155207972 18:23577573-23577595 GGATCCCGCACCGGGGCTGCAGG + Intronic
1155294960 18:24376523-24376545 GGATCCCGCACTGGGGCTGCAGG + Intronic
1155611639 18:27673832-27673854 GGATCTCGCACCAGGGCTGCAGG + Intergenic
1155772947 18:29723934-29723956 GGATCCCACACCGGGGCTGCAGG - Intergenic
1155852349 18:30788862-30788884 GAATCCCACACCAGGGCTGCAGG - Intergenic
1155856306 18:30839102-30839124 GGATCCCTCACTGGGGCTGCAGG + Intergenic
1156038745 18:32794990-32795012 GGATCCCGCACCGGGGCTGCAGG - Intergenic
1156079566 18:33316574-33316596 GGATCTCCCACTGGGGCGGCAGG - Intronic
1156150387 18:34234260-34234282 GGATCCAGCACAGGGGCCGCAGG - Intergenic
1156468797 18:37364485-37364507 GGATCCAGCACTGGGGCTCCAGG + Intronic
1156863729 18:41866174-41866196 GGATCCCGCACCGGGGCTGCAGG - Intergenic
1156943242 18:42795646-42795668 GGATCCCGCACCCGGGCTGCAGG - Intronic
1156969748 18:43139936-43139958 GGATCCCGCACTGGGGCCACAGG - Intergenic
1157086040 18:44581150-44581172 GGATCCCACACCGGGGCTGCAGG - Intergenic
1157661896 18:49452774-49452796 GGATCCTGCACCAGGGCCGCAGG - Intronic
1157749272 18:50163575-50163597 GTATCCAGCACCTGGGCTGCTGG - Intronic
1157856833 18:51111787-51111809 GGATCCCGCACCGGGGCCGCAGG + Intergenic
1157935117 18:51864309-51864331 GGATCCTGCACTGGGGCCACAGG + Intergenic
1157979726 18:52366847-52366869 GGATCCCGCACCAGGGCTGCAGG + Intronic
1158460664 18:57643603-57643625 GGATCCTGCACCAGGGCCGCAGG + Intergenic
1158697186 18:59714036-59714058 GGATCCCGCACCGGGGCTGCAGG + Intergenic
1158705680 18:59790399-59790421 GGATCCCGCACCGGGGCTGCAGG + Intergenic
1159167881 18:64725583-64725605 GGATCCCGCACTGGGGCTGCAGG + Intergenic
1159472871 18:68879939-68879961 GGATCCCGCACCAGGGCTGCAGG + Intronic
1159656031 18:71031281-71031303 GGATCCCGCACCAGGGCTGCAGG + Intergenic
1159670084 18:71212339-71212361 AGATCCTGCACCGGGGCTGCAGG + Intergenic
1159744032 18:72209544-72209566 GGATCCTGCACCGGGGCAGCAGG - Intergenic
1160176544 18:76600074-76600096 GGATCCCGCACCGGGGCTGCAGG + Intergenic
1160198630 18:76777661-76777683 GGATCCCGCACCGGGGCTGCAGG - Intergenic
1160199998 18:76788519-76788541 GGATCCCGCACCAGGGCCACAGG + Intergenic
1160294722 18:77627568-77627590 GCACCCCCCACAGGGGCTGGTGG + Intergenic
1160356685 18:78232988-78233010 GGATTCCCCACAGTGGATGCTGG - Intergenic
1160561089 18:79756067-79756089 GGATCGCCCACGGGGGCAGCGGG + Exonic
1160724335 19:610919-610941 GGATCCTCCCCAGGGGCTCCGGG - Intronic
1160858424 19:1227586-1227608 GGCTCCTGGACACGGGCTGCAGG - Exonic
1160888062 19:1361276-1361298 GGAGCCCGTAGAGGGGCGGCGGG + Intronic
1160893781 19:1393392-1393414 GACTCCCTCACAGGGGCCGCCGG - Intronic
1161166678 19:2791532-2791554 GGATTCCAATCAGGGGCTGCGGG - Intronic
1161279073 19:3435274-3435296 GGCGCCCGCGCAGTGGCTGCCGG - Intronic
1162107072 19:8376181-8376203 GGATCCTGCACCGGGGCTGCAGG - Intronic
1162122046 19:8476831-8476853 GGATGCCGCTGCGGGGCTGCAGG + Intronic
1162230219 19:9259930-9259952 GGATCCTGCACCGGGGCTGCAGG - Intergenic
1162233033 19:9283396-9283418 GGATCCCGCACTGGGGCTGCAGG + Intergenic
1162237822 19:9322013-9322035 GGATCTTGCACTGGGGCTGCAGG - Intergenic
1162261985 19:9541270-9541292 GGATCCCGCACTGGGGCTGCAGG + Intergenic
1162632629 19:11941239-11941261 GGATCCTGCACCAGGGCTGCAGG + Intronic
1162814651 19:13186647-13186669 GTATCCTGCACCGGGGCTGCAGG + Intergenic
1162957657 19:14108012-14108034 GCAGCCGGCACAGGGTCTGCCGG - Intronic
1162987171 19:14278023-14278045 GGATCCCGCACCAGGGCAGCAGG - Intergenic
1163181652 19:15608590-15608612 GGATCCCGCAGCAGGGCTGCAGG + Intergenic
1163218924 19:15900100-15900122 GGATCCCGCACCGGGGCTGCAGG - Intergenic
1163329148 19:16625639-16625661 GGCTCCAGCACAGGTGCTGCCGG - Intronic
1163362163 19:16853461-16853483 GGTTCCCGCCCAGGGTCTGTGGG + Intronic
1163558834 19:18007345-18007367 GGAGCAGGCACAAGGGCTGCGGG + Intronic
1164270519 19:23668471-23668493 GGATCCCGCACCGGGGCTGCAGG + Intronic
1164310531 19:24041731-24041753 GGATCCCGCACCGGGGCTGCAGG - Intronic
1164975867 19:32572001-32572023 GGATCCCTCACCGGGGCTGCAGG - Intergenic
1165036455 19:33037018-33037040 GGATCCCACACCAGGGCCGCAGG - Intronic
1165266995 19:34668562-34668584 GGATCCCGCACCGGGGCCACAGG - Intronic
1165415461 19:35691040-35691062 GGATCCCGCACTGGGGCTGCAGG + Intergenic
1165846654 19:38821884-38821906 GGATCCTGCACCAGGGCCGCAGG - Intronic
1166036144 19:40170084-40170106 GGATCCCGCACTGGGGCTGCAGG + Intergenic
1166649662 19:44563185-44563207 GGATCTCGCACCGGGGCTGCAGG + Intergenic
1168132265 19:54329119-54329141 AGATTCTGCACAGGGCCTGCTGG - Intergenic
1168691662 19:58381061-58381083 GGAACCCGCGCGGGGACTGCTGG + Intergenic
925088619 2:1134669-1134691 GGATCCCCCACCGGGGCTGCAGG + Intronic
925098903 2:1229542-1229564 GGATCCGGCACCGGGGCTGCAGG + Intronic
925537736 2:4935258-4935280 GGATCCCGCACCGGGGCTGCAGG + Intergenic
926097563 2:10091834-10091856 GGATGTCGCACCAGGGCTGCAGG - Intergenic
926616557 2:15002478-15002500 GGATCCCGCACCGGGACTGCAGG + Intergenic
926685769 2:15696718-15696740 GGATCCTGCACTGGGGTCGCAGG + Intronic
926850720 2:17193928-17193950 GGATCCGGCACAGGGGCTGCAGG - Intergenic
927357149 2:22186715-22186737 GGATCCCGCACTGGGGCCGCAGG - Intergenic
927777866 2:25915878-25915900 GGATCCCCCACGGGGGCTGCAGG - Intergenic
927900478 2:26814776-26814798 GGATCCCGCACCAGGGCTGCAGG - Intergenic
927942121 2:27111457-27111479 GGATCCTGCACCGGGGCCGCAGG + Intronic
928106426 2:28473048-28473070 GGATCCTGCACTGGGGCCGCAGG - Intronic
928753269 2:34494710-34494732 GGATCCCGCACCAGGGCTGCAGG - Intergenic
928880652 2:36092657-36092679 GGATCCCGCACCGGGGCTGCAGG - Intergenic
929109937 2:38397679-38397701 GGATCCCACACCAGGGTTGCAGG - Intergenic
929201929 2:39244692-39244714 GGATCCCGCACAGGGGCTGCAGG - Intergenic
929233783 2:39585772-39585794 GGATCCCGCACCGGGGCTGCAGG - Intergenic
929379762 2:41336007-41336029 GGATCCCGCACCAGGGCTGCAGG - Intergenic
929890793 2:45917614-45917636 GGATCCCGCACTGGGGCTGCAGG + Intronic
930038088 2:47100149-47100171 GGATCCCACACCAGGGCTGCAGG - Intronic
930039288 2:47107696-47107718 GGATCCCGCACCAGGGCTGCAGG - Intronic
930420807 2:51151558-51151580 GGACCCCACACTGGGGCTGCAGG + Intergenic
930468157 2:51780279-51780301 GGATCCTGCACCGGGGCTGCAGG + Intergenic
930485586 2:52007225-52007247 GGATCCCAAACCGGGGCTGCAGG - Intergenic
930605234 2:53486446-53486468 GGATCCTGCACTGGGGCCACGGG - Intergenic
931708764 2:64969421-64969443 GGATCCCACTCTGGGGCTGCAGG - Intergenic
932240002 2:70148722-70148744 GGATCCCACACTGGGGCTGCAGG - Intergenic
932359451 2:71092431-71092453 GGATCCTGCATGGGGGCTGCAGG + Intergenic
932486551 2:72087298-72087320 GGATCCCGCACCGGGGCTGCAGG - Intergenic
932521847 2:72422243-72422265 GGATCCCGCACTGGGGCTGCAGG - Intronic
932902120 2:75711991-75712013 GGATCCCGCACCGGGGCTGCAGG - Intergenic
933060769 2:77734723-77734745 GGATCCGGCACCGGGGCCGCAGG + Intergenic
933415893 2:81985574-81985596 GGATCCCGTGCAGGGGCCGTGGG - Intergenic
933442025 2:82326227-82326249 GGGTCCCGCACCGGGGCTGCAGG + Intergenic
933487180 2:82938385-82938407 GGATCCCGCACCAGGGCTGCAGG + Intergenic
933506386 2:83181416-83181438 GGATCCCGCACCGGGGCCGCAGG - Intergenic
933511395 2:83245910-83245932 GGATCCCGCATGGGGGCTGCAGG + Intergenic
933712086 2:85334357-85334379 GGATCCCGCACTAGGGCCGCAGG + Intergenic
934479460 2:94622144-94622166 GGATCCCGCGCTGGGGCCGCTGG + Intergenic
934853785 2:97716869-97716891 GTGTCCAGCACTGGGGCTGCAGG - Intronic
934898566 2:98139419-98139441 GGATCCCACACAGGGGCTTCAGG - Intronic
935866512 2:107392704-107392726 GGATCTCACACAGGGGCCGCAGG - Intergenic
935896771 2:107747284-107747306 GGATCCCGCACCGGGGCTGCAGG + Intergenic
936172637 2:110190176-110190198 AGATCCCGCACCAGGGCTGCAGG + Intronic
936346963 2:111682267-111682289 GGATCCTGCACCGGGGCTGCAGG - Intergenic
936581448 2:113704366-113704388 GGATCCCGCACAGGGGCCACAGG + Intergenic
937181206 2:119997403-119997425 GGATCTCGCACTGGGGCTGCAGG - Intergenic
937209523 2:120259694-120259716 GGATCCCGCACCGGGGCTGCAGG + Intronic
937596921 2:123684192-123684214 GGATCCCACACCGGGGCTGCAGG - Intergenic
937711774 2:124987354-124987376 GGATCCTGCACCGGGGATGCAGG + Intergenic
937746668 2:125422665-125422687 GGATCCCACACTGGGGCTGCAGG - Intergenic
937932447 2:127217894-127217916 GGAGTCCTCAGAGGGGCTGCAGG + Intronic
937932873 2:127219672-127219694 GGACCCCGGAGAGGGGCAGCAGG - Intronic
938126006 2:128672066-128672088 GGATCCTGCACCGGGGCTGCAGG + Intergenic
938401097 2:130991861-130991883 GGATCCCGCACCGGGGCTGCAGG - Intronic
938725957 2:134109290-134109312 GGATCCTGCAGCGGGGCGGCAGG + Intergenic
939003200 2:136758837-136758859 GGATCCCGCACAGGGGCCGCAGG - Intergenic
939053145 2:137331551-137331573 GGATCCAGCACTGGGGCTGCAGG + Intronic
939229837 2:139410758-139410780 GGATCCCGCACCGGGGCTGCAGG - Intergenic
939281827 2:140074196-140074218 GGATCCCGTACCTGGGCTGCAGG - Intergenic
939738698 2:145880847-145880869 GGATCCCGCACTGGGGCTGCAGG + Intergenic
939745348 2:145960517-145960539 GGATCCCACACCAGGGCCGCAGG + Intergenic
939777287 2:146403635-146403657 GGATCCCGCACTGGGGCTGCAGG + Intergenic
940112588 2:150171045-150171067 GGATCCCGAACTGGGGCCGCAGG + Intergenic
940215166 2:151296373-151296395 GGATCCTGCACGGGGGCCGCAGG - Intergenic
940666632 2:156617978-156618000 GGATCCCGCACTGGGGCTGCAGG + Intergenic
940784536 2:157967858-157967880 GGATCCCCCACGGAGCCTGCAGG + Intronic
941178996 2:162235331-162235353 GGATCTCGCACCGGAGCCGCAGG - Intronic
941240161 2:163026693-163026715 GGATCCCGCACCGGGGCTGCAGG - Intergenic
941309858 2:163914034-163914056 GGATCCCGCACCAGGGCTGCAGG - Intergenic
941397856 2:164994698-164994720 GGATCCCGCACGGGGGCTGCAGG + Intergenic
941705799 2:168657382-168657404 GGATCCCGCACCGGGGCTGCAGG + Intronic
941712047 2:168724841-168724863 GGATCCCCCACCGGGGCTGCAGG + Intronic
941820864 2:169841950-169841972 GGATCCCGCACCGGGGCTACAGG - Intronic
942170183 2:173282536-173282558 GGATCTCGCACAGGGGCCACAGG + Intergenic
942317520 2:174709513-174709535 GAATCTCGCACCGGGGCCGCAGG + Intergenic
942368586 2:175256945-175256967 GGATCCCGCGCTGGGGCGGCAGG + Intergenic
942540263 2:177008267-177008289 GGATCCCACACCAGGGCCGCAGG - Intergenic
942620083 2:177836088-177836110 GGATCCCGCACTGGGGCCACAGG - Intronic
942867360 2:180691804-180691826 GGATCCTGCACGGGGGCTGCAGG - Intergenic
943106089 2:183546622-183546644 GGATCCTGCACTGGGGCAGCAGG + Intergenic
943494673 2:188606338-188606360 GGATCCCGCACCAGGGCTGCAGG + Intergenic
943656347 2:190512847-190512869 GGAGCCCGCACAGAAGATGCTGG - Intronic
943790104 2:191922004-191922026 GGATCCCGCACCGGGGCCGCAGG - Intergenic
943835227 2:192508385-192508407 GGATCCCGCACTGGGGCTGCAGG - Intergenic
943906050 2:193502405-193502427 GGATCCTGCACCCGGGCAGCAGG + Intergenic
943941381 2:194002701-194002723 GGATCCCGCTTTGGGGCCGCAGG + Intergenic
943942796 2:194020577-194020599 GGATCCCACACTGGGGCCACAGG - Intergenic
943955025 2:194176780-194176802 GGATCTCCCACTGGGGCTGCAGG - Intergenic
944058419 2:195547295-195547317 GGATCTCACACTGGGGCCGCAGG + Intergenic
944252417 2:197591498-197591520 GGATACTGCACTGGGGCGGCAGG + Intronic
944729712 2:202503787-202503809 GGATCCCACACCTGGGCTGCAGG - Intronic
944857858 2:203785517-203785539 GGATCCCGCACCGGGGCTGCAGG + Intergenic
945069703 2:205977601-205977623 GGATCCCGCACAGGGGCCGCAGG - Intergenic
945401457 2:209387751-209387773 GGATCTCGCACTGGGGCTGCAGG - Intergenic
945451424 2:210000560-210000582 GGATCCCATACTGGGGCGGCAGG + Intergenic
945575401 2:211524321-211524343 GGATCCCTCACGGGGGCTGCAGG + Intronic
945664149 2:212721013-212721035 GGATCCTGCGCTGGGGCCGCAGG + Intergenic
945744293 2:213701643-213701665 GGATCCTGCGCCAGGGCTGCGGG - Intronic
945745853 2:213718908-213718930 GGATCCCGCACCAGGGCTGCAGG - Intronic
945870289 2:215219479-215219501 GGATCTCACACTGGGGCTGCAGG - Intergenic
945872758 2:215245684-215245706 GGATCCCGCACCGGGGCTGCAGG + Intergenic
946054065 2:216885640-216885662 GGATACCACACTGGGGCTGCAGG - Intergenic
946358013 2:219201371-219201393 GGATACCGCACCGTGGCTGCAGG + Intronic
946376571 2:219313193-219313215 GGATCCCACACCGGGGCCGCAGG - Intergenic
946982092 2:225229392-225229414 GGATCCCGCATCGGGGCTGCAGG + Intergenic
947026707 2:225744550-225744572 GGATCCCGCACCAGGGCTGCAGG - Intergenic
947720501 2:232366757-232366779 GGATTCCGCACCGGGGCTGCAGG - Intergenic
947749151 2:232523815-232523837 GGACCCCCCCCAGGAGCTGCAGG + Exonic
947931984 2:233972412-233972434 GGATCCCGCACCGCGGCTGCAGG + Intronic
947962122 2:234248092-234248114 GGATCCCGCACCAGGACCGCAGG - Intergenic
948054476 2:235000830-235000852 AGAACCCACACAGAGGCTGCTGG - Intronic
948449039 2:238057797-238057819 GGATCCCCCACTGCGGCTGCAGG + Intronic
1168797333 20:620349-620371 GGGGCCAGCACAGGAGCTGCTGG + Intergenic
1169021838 20:2336201-2336223 GGATCAGGCACAGGGGCTACAGG - Intronic
1169131147 20:3166976-3166998 GGTACCCGCACAGGGGGTGGGGG - Exonic
1169645281 20:7803503-7803525 GGATCCCGCAGGAGAGCTGCAGG + Intergenic
1169814383 20:9641533-9641555 GGATCCCGCACCGGGGCTGCAGG + Intronic
1169849262 20:10032095-10032117 GAATCCCGCACGAGAGCTGCAGG - Intronic
1170230813 20:14044772-14044794 GGATCCCGCACTGGGGCTGCAGG + Intronic
1170246542 20:14226923-14226945 GGATCCTGCACTGGGGCTGCAGG - Intronic
1170538274 20:17363259-17363281 GGATCCAGCAGAGGGGATGATGG - Intronic
1170649573 20:18227181-18227203 GGATCCAGCACCAGGGCAGCAGG - Intergenic
1170806775 20:19639572-19639594 GGATCCCGCACTGGGGCTGCAGG + Intronic
1170989965 20:21292296-21292318 GGATCCCGCACCGGGGCTGCAGG - Intergenic
1171318776 20:24220665-24220687 GGATCCCACACCGGGGCTGCAGG + Intergenic
1171370346 20:24658413-24658435 AGATTCCACACAGGAGCTGCAGG + Intronic
1171416435 20:24984228-24984250 GTATCCCACACAGGGGAAGCTGG - Intronic
1171973345 20:31578512-31578534 GGATCCCGCACAGGGGCTGCAGG + Intergenic
1172431779 20:34898745-34898767 GGATCCCGCACTGGGGCTGCAGG + Intronic
1172485668 20:35296495-35296517 GGCTCCCGCAGAGGAGCAGCTGG + Intergenic
1173195457 20:40910413-40910435 GGATCCCGCACTGGGGCTGCAGG + Intergenic
1173195761 20:40911600-40911622 GGATCCCGCACTGGGGCTGCAGG - Intergenic
1173345988 20:42200474-42200496 GGATCCCACAGTGGGGCTGTTGG - Intronic
1173372417 20:42448949-42448971 GCATGCAGCCCAGGGGCTGCTGG + Intronic
1173601671 20:44299551-44299573 GGATCCCGCACCGGGGCTGCAGG - Intergenic
1173778843 20:45736308-45736330 GGGTCCCGCTCTGGGGCCGCAGG - Intergenic
1174162820 20:48564053-48564075 GGATCCCATACTGGGGCCGCAGG + Intergenic
1175210144 20:57348814-57348836 GGATCCCGCACCGGGGCTGCAGG - Intergenic
1175254223 20:57629205-57629227 GGATCCTGCCCCGGGGCTGCAGG - Intergenic
1175717996 20:61268246-61268268 GGATCCCGAGGAGGGGCTCCAGG + Intronic
1175831804 20:61968658-61968680 GGAGCCCTTCCAGGGGCTGCAGG - Intronic
1175871697 20:62212318-62212340 CCATCCCGCACAGGAGCTCCAGG + Intergenic
1175922277 20:62455828-62455850 GGAGCCCCCACAGGGGCTGGGGG - Intergenic
1176164147 20:63664145-63664167 GGTTCCCTGACAGGAGCTGCCGG + Intronic
1176189446 20:63800949-63800971 GGATCCGGCACTGGGGCTGCAGG - Intronic
1176332230 21:5559595-5559617 GGATCCCCCACAGGGTCTGCAGG + Intergenic
1176344764 21:5733452-5733474 GGATCCCGCACCAGGGCCGCAGG + Intergenic
1176351578 21:5854036-5854058 GGATCCCGCACCAGGGCCGCAGG + Intergenic
1176395527 21:6261356-6261378 GGATCCCCCACAGGGTCTGCAGG - Intergenic
1176441630 21:6727748-6727770 GGATCCCCCACAGGGTCTGCAGG + Intergenic
1176465892 21:7054817-7054839 GGATCCCCCACAGGGTCTGCAGG + Intronic
1176489453 21:7436595-7436617 GGATCCCCCACAGGGTCTGCAGG + Intergenic
1176500063 21:7591003-7591025 GGATCCCGCACCAGGGCCGCAGG - Intergenic
1176539085 21:8131522-8131544 GGATCCCGCACCAGGGCCGCAGG + Intergenic
1176558036 21:8314567-8314589 GGATCCCGCACCAGGGCCGCAGG + Intergenic
1176618898 21:9042102-9042124 GTACCCAGCACAGGGGCTGATGG + Intergenic
1176663292 21:9660418-9660440 GGATCCTGCACCAGGGCCGCAGG - Intergenic
1176671111 21:9735953-9735975 GGATCCCGCACTGGGGCCGCAGG - Intergenic
1176869194 21:14072862-14072884 GGGCCCGGCGCAGGGGCTGCTGG + Intergenic
1176869504 21:14074084-14074106 GGGCCCAACACAGGGGCTGCAGG + Intergenic
1176872178 21:14092909-14092931 GGATCTCGCACAGGGGCCACAGG + Intergenic
1176966543 21:15218519-15218541 GGATCCCGCACCGGGACTGCAGG + Intergenic
1177318789 21:19493956-19493978 GGATCCCGCACCGGCGCAGGTGG - Intergenic
1177497005 21:21902841-21902863 GGATCCCACACGGGGGCTGCAGG - Intergenic
1177549174 21:22598211-22598233 GGATCCTGCGCTGGGGCCGCAGG - Intergenic
1177565758 21:22818802-22818824 GGATCCCACACCGGGGCTGCAGG + Intergenic
1177637690 21:23807432-23807454 GGATCCCACACTGGGGCTGCAGG - Intergenic
1178054602 21:28784174-28784196 GGATCCTACACCGGGGCCGCAGG - Intergenic
1178074247 21:29000556-29000578 GGATCCCGTACCCGGGTTGCAGG - Intergenic
1178082166 21:29077139-29077161 GGATCACGCACTAGGGCTACAGG + Intergenic
1178327065 21:31654602-31654624 GGATCCCGCACCTGGGCTGCAGG - Intergenic
1178398817 21:32265748-32265770 GGATCCCGCACCGGGGCTGCAGG - Intergenic
1179358114 21:40681250-40681272 GGACCAAGCACAGGGGCGGCAGG - Intronic
1179634057 21:42696276-42696298 GGATCCCACACAGTGCCGGCGGG - Intronic
1180740969 22:18053313-18053335 GGATCCCGCACAGGGGCTGCAGG + Intergenic
1180755162 22:18155904-18155926 GGATCCCACACCTGGGCCGCAGG - Intronic
1181077601 22:20392354-20392376 GGATCCCGCACCGGGGCCGCAGG + Intergenic
1181450470 22:23016996-23017018 GGATCCCGCGCCGGGGCTGCAGG + Intergenic
1182288822 22:29263850-29263872 GGAGGCCGCAAAGGAGCTGCAGG + Exonic
1183285488 22:36959924-36959946 TGACCCGGCACAGGGTCTGCGGG + Intergenic
1183422047 22:37717784-37717806 GGATCTCGTTCTGGGGCTGCAGG + Intronic
1183685310 22:39358016-39358038 GGATCCCGCACCGGGGCTGCAGG - Intronic
1184584328 22:45437145-45437167 GGATTCCGCACCGGGGCTGCAGG - Intergenic
1184723211 22:46328161-46328183 GGACCCTGCACGGGCGCTGCTGG - Intronic
1184759244 22:46535625-46535647 GGATCCCGCTCAGCGAGTGCAGG + Exonic
1184906174 22:47488250-47488272 GGATTCCGCACCGGGGCTGCAGG + Intergenic
1184950535 22:47839551-47839573 GCATCCTGCACAGGCGCTCCTGG + Intergenic
1185039456 22:48497035-48497057 TGGTCCCGCACAGGGACTGCAGG + Intronic
1185229044 22:49670150-49670172 GGATCCTGCACCGAGGCTGCAGG + Intergenic
1203244035 22_KI270733v1_random:47877-47899 GGATCCCGCACCAGGGCCGCAGG + Intergenic
949259053 3:2084044-2084066 GGATCCCGCACCGGGGCTGCAGG - Intergenic
949292830 3:2485329-2485351 GGATCCTGCACTGGGGCCACAGG - Intronic
950203672 3:11061789-11061811 AGATCCCGCACAGGGGCTGCAGG - Intergenic
950207957 3:11094416-11094438 GGATCCCACACAGGGGCCGCAGG - Intergenic
950256585 3:11511540-11511562 GGATCCTGCACTGGGGCTGCAGG + Intronic
950256891 3:11513189-11513211 GGATCCCGCACCGGGGCTGCAGG + Intronic
950418623 3:12883266-12883288 GGATCCCGCACCGGGGCCACAGG - Intergenic
950463984 3:13142455-13142477 GGATCCCGCACAGGTGGAGATGG + Intergenic
950485835 3:13273614-13273636 GGATCCTGGGCAGAGGCTGCTGG - Intergenic
950513295 3:13447140-13447162 GGATCCCGCACTGGGGCTGCAGG + Intergenic
950600311 3:14029439-14029461 GGATCCTGCACCGGGGCTGCAGG + Intronic
950601305 3:14037622-14037644 GGATCCCGTGCCGGGGCCGCGGG - Intronic
950632711 3:14293588-14293610 GGATCCCGCACGGGGGCCGCAGG - Intergenic
950929468 3:16774133-16774155 GGATGCCGCACTGGGGCTGCAGG - Intergenic
951024780 3:17817616-17817638 GGATCCTGCACAGGGGCCGCAGG + Intronic
951146519 3:19234228-19234250 GGATCCCGCACCGGGGCTGCAGG + Intronic
951185037 3:19702944-19702966 GGATCCTGCACCAGGGCCGCAGG - Intergenic
951332884 3:21387195-21387217 GGATGCCACACCGGGGCTGCAGG + Intergenic
951551802 3:23882475-23882497 GGATCCTGTGCCGGGGCTGCGGG + Intronic
952058016 3:29473448-29473470 GGATCCCGCACGGAGGCCGCAGG + Intronic
952275323 3:31870532-31870554 GGATCCCGCACCGGGGCTGCAGG - Intronic
952355452 3:32579131-32579153 GGATCCCCCACTGGGGCCGCAGG - Intergenic
952360545 3:32626051-32626073 GGATCCCTCACAGGGGCGGCAGG - Intergenic
952398303 3:32940099-32940121 GGATCCCGCACTGGGGCTGCAGG - Intergenic
952593715 3:34988794-34988816 GGATCCCCCACTGGGGCTGCAGG - Intergenic
952713386 3:36453719-36453741 GGATCCCGCACCGGGGCTGCAGG - Intronic
952795323 3:37233435-37233457 GGGTCCCGCACTGGGGCTGCAGG - Intergenic
953002963 3:38951568-38951590 GGATCCCGCACCGGGGCCGCAGG - Intergenic
953089904 3:39713732-39713754 GGATCCCGCACCGGGGCTGCAGG - Intergenic
953124430 3:40077852-40077874 GGATCCCGCACCGGGGCTGCAGG + Intronic
953307530 3:41844112-41844134 GGATCCCCCACCGGGGCCGCAGG + Intronic
953522423 3:43656370-43656392 GGATCCCGCACAGGGGCTGCAGG + Intronic
953673996 3:44986060-44986082 GGATCCTGCACTGGGGCCGCAGG + Intronic
953714692 3:45307104-45307126 GGATCCCACACTGGGGCCACAGG - Intergenic
954041073 3:47887625-47887647 GGATCTCGCACTGGGGCTGCAGG - Intronic
954089258 3:48271884-48271906 GGATCCCGCACTGGGGCTGTGGG + Intronic
954226131 3:49182608-49182630 GGATCCCGCACTGGGGCTGCAGG + Intronic
954230512 3:49213481-49213503 GGATCCTGCACTGGGGCCGCAGG + Intronic
954620211 3:51990989-51991011 GGATCCCGCACCGGGGCTGCAGG - Intergenic
954629694 3:52041121-52041143 TGTTCCTGCACAGGGGCTGAGGG - Intergenic
955183429 3:56692297-56692319 GGATCCCGCACTGGGGCTGCAGG - Intergenic
955210359 3:56934882-56934904 GGATCCCGCAGCGGGGCTGCAGG - Intronic
955266386 3:57449289-57449311 GGATCCCACACCCGGGCTGCAGG + Intronic
955449552 3:59051274-59051296 GGATCCCGCACTGGGGCCGCAGG - Intergenic
956183865 3:66544588-66544610 GGATCACGCACCAGGGCTGCAGG + Intergenic
956195813 3:66651944-66651966 GGATCCTGCACCGGGGCTGCAGG - Intergenic
956392129 3:68785256-68785278 GGATCTCGCACTGGGGCTGCAGG + Intronic
956438893 3:69260669-69260691 GGATCCCGTGCTGGGGCTGCGGG - Intronic
956459300 3:69454845-69454867 GGATCCCACGCAGGGGCCACGGG - Intronic
956481527 3:69677862-69677884 GGATCCCGCACCGGGGCTGCAGG - Intergenic
956563700 3:70612230-70612252 GGATCTTGCACCAGGGCTGCAGG - Intergenic
956632672 3:71331514-71331536 GGATCCCGCACCGGGGCCGCAGG - Intronic
956855334 3:73269609-73269631 GGATCCCGCACCGGGGCTGCAGG - Intergenic
957002198 3:74899919-74899941 GGATCCTGCATGGGGGCTGCAGG + Intergenic
957009111 3:74985069-74985091 GGATCCCACACCGGGGCTGCAGG + Intergenic
957056096 3:75444378-75444400 GGATCCCACACGGGGGCCACAGG + Intergenic
957074153 3:75588171-75588193 GGATCCCACACAGGAGCCACAGG - Intergenic
957277542 3:78108805-78108827 GGATCCCGCTCGGGGGCTGCAGG - Intergenic
957362157 3:79173739-79173761 GGATCCCGCACTGGGGCCACAGG - Intronic
957419588 3:79951314-79951336 GGATCCCGCATGGGGGCTGCAGG + Intergenic
957446191 3:80314865-80314887 GGATCCCACACTGGGGCTGCAGG - Intergenic
957556223 3:81767320-81767342 GGATCCCGCACTGGGGCCACAGG + Intergenic
957560091 3:81811952-81811974 GGATCCCGCACCGGGGCTGCAGG + Intergenic
957631012 3:82715747-82715769 GGATCCCGCATGGGGGCTGCAGG - Intergenic
957804829 3:85133804-85133826 GGATCCCTCACCGGGGCTGCAGG + Intronic
957829937 3:85504619-85504641 AGATACCTCACCGGGGCTGCAGG + Intronic
957885564 3:86282642-86282664 GGATCCGGCAGTGGGGCCGCAGG - Intergenic
957919606 3:86731454-86731476 GGATCCCGCACCAGGGCTGCAGG + Intergenic
957921896 3:86758016-86758038 GGATCCCGCACTGGGGCTGCAGG - Intergenic
957995180 3:87679515-87679537 GGATCCCACACGCGGGCTGCAGG - Intergenic
958022714 3:88016105-88016127 GGATCCCCCACCGGGGCTGCAGG - Intergenic
958419945 3:93918001-93918023 GGATCCTGCACTGGGGCTGCAGG - Intronic
958810690 3:98857916-98857938 GGATCCCGCACCGGGGCTGCAGG + Intronic
959422809 3:106149050-106149072 GGATCTCGCACAGGGGCTGCAGG - Intergenic
959991677 3:112638530-112638552 GAACCCAGCACAAGGGCTGCTGG - Exonic
960149725 3:114238233-114238255 GGATCCCGCACCGGGGCTGCAGG + Intergenic
960199335 3:114812640-114812662 GGATCCCGCACCCGGGCTGCAGG + Intronic
960449630 3:117790533-117790555 GCCTCTCCCACAGGGGCTGCAGG + Intergenic
960669278 3:120140665-120140687 AGATCCTGCACGGGGGCCGCAGG - Intergenic
960685560 3:120290086-120290108 GGATCCCACACTGGGGCCACAGG - Intergenic
960761593 3:121078475-121078497 GGATCCTGCACCAGGGCCGCAGG + Intronic
960868515 3:122227158-122227180 GGATCCCGCACCGGGACCACAGG + Intronic
961268875 3:125672158-125672180 GGATCCCCCACAGCGGCGGTAGG - Intergenic
961279939 3:125758569-125758591 GGATCCCGCACAGGAGCTGCAGG + Intergenic
961460536 3:127047094-127047116 GGATCCCGCACCGGGGCTGCAGG - Intergenic
961461930 3:127056214-127056236 GGATCCCGCACAGGGGCTGCAGG + Intergenic
961464980 3:127076228-127076250 GGATCCCACACCGGGGCCGCAGG + Intergenic
961874456 3:130011010-130011032 GGATCCCACACAGGAGCCGCAGG - Intergenic
961932249 3:130547008-130547030 GGATCCTGCATGGGGGCAGCAGG + Intergenic
961956964 3:130814785-130814807 GGATCCCGCACCAGGGCCGTGGG + Intergenic
962283676 3:134070204-134070226 GGATCCCACACCGGGGCTGCAGG + Intronic
962398680 3:135039370-135039392 GGATCCCGCACTGGGGCTGCAGG + Intronic
962590999 3:136889944-136889966 GGATCCCGCACAGGGGTTGCAGG + Intronic
962600425 3:136987531-136987553 GGATCCCGCACCAGGGCTGCCGG + Intronic
962758326 3:138485066-138485088 GGGTCCCACACCAGGGCTGCAGG - Intergenic
963397289 3:144750225-144750247 GGATCCCGCACCAGGGCTGCAGG - Intergenic
963397968 3:144757311-144757333 GGATCCCGAGCCAGGGCTGCAGG - Intergenic
963440483 3:145333794-145333816 GGATCCCGCACCGGGGCTGCAGG - Intergenic
963509082 3:146225375-146225397 GGATCCCGCAGCAGGGCTGCAGG + Intronic
963589918 3:147245548-147245570 GGATCCTGCACCGGGGCTGCAGG + Intergenic
963651754 3:147989320-147989342 GGATCCCGCACCAGGACTGCAGG + Intergenic
963673437 3:148280509-148280531 GGATCCCGCACTGGGGCCGCAGG + Intergenic
963742848 3:149097664-149097686 GGATCCTGCACCTGGGCTGCAGG + Intergenic
963744228 3:149109773-149109795 GGATCCTGCACCCGGGCTGCAGG - Intergenic
963760665 3:149284403-149284425 GGATCCCGCACCAGGGCCGCAGG - Intergenic
963862252 3:150323387-150323409 GGATCCAGCACCGGGGTTGCAGG - Intergenic
964014459 3:151928573-151928595 GGATCCCGCACCGGAGCTGCAGG - Intergenic
964032399 3:152152836-152152858 GGATCCCTTACCGGGGCTGCAGG - Intergenic
964037609 3:152217718-152217740 GGATCACGCACCAGGGCCGCAGG - Intergenic
964117900 3:153155692-153155714 GGATCGCGCAATGGGGCTGCAGG + Intergenic
964138279 3:153369695-153369717 GGATCCCGTGCTGGGGCTGTGGG + Intergenic
964139150 3:153378279-153378301 GGATCCCGCACTGGGGCTGCAGG + Intergenic
964375119 3:156041683-156041705 GGATCTCCCACCGGGGCCGCAGG - Intronic
964381167 3:156099841-156099863 GGATCCCTCACCGGGGCCGCAGG - Intronic
964383346 3:156120618-156120640 GCAGCCCGGACAGGGGCAGCGGG + Exonic
964444076 3:156740994-156741016 GGATCCCGCACAGGGGATGCAGG - Intergenic
964751933 3:160060945-160060967 GGACCCTGCACAGGGGCTACAGG - Intergenic
964802819 3:160573932-160573954 GGATCCCGCACCCTGGCTGCAGG + Intergenic
964974248 3:162600120-162600142 GGATCTCGCACTGGGGTTGCAGG - Intergenic
964983081 3:162710451-162710473 GGATCCCGCGCCAGGGCCGCAGG + Intergenic
964993439 3:162844559-162844581 GGATCCTGCACTGGGGCCGCAGG + Intergenic
965040371 3:163499441-163499463 GGATCTCACACTGGGGCTGCAGG - Intergenic
965078070 3:164003385-164003407 GGATCCCGCACTGGGGCTGCAGG - Intergenic
965109345 3:164401832-164401854 GGATCCCGCACCGGGGCTGCAGG + Intergenic
965200272 3:165649260-165649282 GGATCCCGCACTGCGGCTGCAGG + Intergenic
965220138 3:165918389-165918411 GGATCCTGCACCGGTGCTGCAGG + Intergenic
965220825 3:165924280-165924302 GGATCCCGCACCTGGGCGGCAGG + Intergenic
965288118 3:166843228-166843250 GGATCCCACACCAGGGCTGCAGG - Intergenic
965298201 3:166976250-166976272 GGATCCCGCACCGGGGCTGCAGG - Intergenic
965360670 3:167735013-167735035 GGATCCCCCGCATGGCCTGCCGG - Intergenic
965446538 3:168780525-168780547 GGATCCAGCACCAGGGCTGCAGG - Intergenic
965753156 3:171998814-171998836 GGATCCCACACTGGGGCTGCAGG + Intergenic
965837447 3:172867199-172867221 GGATCCCACACCAGGGCTGCAGG - Intergenic
965913626 3:173814074-173814096 GGGCCCAGCTCAGGGGCTGCTGG - Intronic
965943407 3:174211915-174211937 AGATCCCGCACTGGGGCTGCAGG + Intronic
966076132 3:175937789-175937811 GGATCGTGCACTGGGGCTGCAGG - Intergenic
966096711 3:176213359-176213381 GGATCCCGCACTGGGGCTGCAGG + Intergenic
966108140 3:176362169-176362191 GGATCCTGCACTGGGGTCGCAGG + Intergenic
966190939 3:177271671-177271693 GGATCCTGCACCGGGGCTGCAGG + Intergenic
966246004 3:177808893-177808915 GGATCTTGCACCGGGGCTGCAGG + Intergenic
966372356 3:179262997-179263019 GGATCCCGCACCGGGGCCACAGG + Intronic
966548903 3:181182962-181182984 GGATCCCTCACAGGGGCTGCAGG + Intergenic
966725077 3:183101317-183101339 GGATCCCGCACCGGGGCTGCAGG - Intronic
966725356 3:183103690-183103712 GGGTCCGGCACTGGGGCTGCAGG + Intronic
967594842 3:191316956-191316978 GGATCCCACGCCGGGGCTGCCGG + Intronic
967718433 3:192789449-192789471 GGATACCGCACCAGGCCTGCAGG - Intergenic
968181519 3:196598981-196599003 GGATCCCGCACTGGGGCTGCAGG + Intergenic
968412738 4:403943-403965 GGATCCCGCGCCGGGGCTGCAGG + Intergenic
968469743 4:773945-773967 GGATCCTGCGCTGGGGCTGCAGG - Intergenic
968478283 4:822923-822945 GGAGCCCCCCCAGGGTCTGCTGG + Intronic
968583537 4:1405740-1405762 GGGTCAGGCCCAGGGGCTGCAGG - Intronic
968649986 4:1756733-1756755 CAATCCCCCACAGGGGCTGAAGG + Intergenic
968716233 4:2161685-2161707 GGATCTCGCACAGGGGCTACAGG - Intronic
968998904 4:3964659-3964681 GGATCCCTCACGGGGGCCGCAGG + Intergenic
969017772 4:4115771-4115793 GGATCCCACACAGGAGCCGCAGG - Intergenic
969303075 4:6308977-6308999 GGATCCCCCAACCGGGCTGCAGG + Intergenic
969362429 4:6673140-6673162 GGATCCCACACCAGGGCTGCAGG - Intergenic
969440814 4:7215546-7215568 GGATCCCGCACCGGGGCTGCAGG - Intronic
969654904 4:8491353-8491375 GGATCCCGCACCAGGGCAGCAGG + Intronic
969755091 4:9143974-9143996 AGATCCCACACGGGGGCCGCAGG - Intergenic
969795418 4:9524404-9524426 GGATCCCGCACAGGAGCTGCAGG + Intergenic
969814998 4:9680257-9680279 GGATCCCACATGGGGGCCGCAGG - Intergenic
970007293 4:11424096-11424118 AGATCCAGCACAGGGGCTGCAGG - Intronic
970182662 4:13415800-13415822 GGATCCTGCACTGGGGCTGCAGG - Intronic
970272183 4:14359030-14359052 GGATCCTGCAATGGGGCCGCAGG - Intergenic
970615683 4:17766752-17766774 GGATCCCGCACCGGGGCAGCAGG + Intronic
970649249 4:18159213-18159235 GGATCCCGCACCGGGGCTGCAGG + Intergenic
970673090 4:18418280-18418302 GGATCCCGCACCGGGGCTGCAGG + Intergenic
970803606 4:20004432-20004454 GGATCCCGCACCGGGGCTGCAGG - Intergenic
970817810 4:20178954-20178976 GGATCCCGTACTAGGGCTGCAGG + Intergenic
971280458 4:25239185-25239207 GGATCCCACACTGGGGCCACAGG + Intronic
971281608 4:25246567-25246589 GGATCCCACACTGGGGCCACAGG + Intronic
971377036 4:26063913-26063935 GGATCCCGCACTGGGGCTGCAGG + Intergenic
971552966 4:27978278-27978300 GGATCCCACACTGGGGCTGCAGG + Intergenic
971563633 4:28113193-28113215 GGATCCCACACCTGGGCTGCAGG - Intergenic
971618852 4:28828424-28828446 GGATCCTGCACTGGGGCCACAGG - Intergenic
971639896 4:29117771-29117793 GGATCCCGCACTGGGGCTGCAGG - Intergenic
971709533 4:30093124-30093146 GGATCCCGCTCTGGGGCTGCAGG - Intergenic
971792276 4:31184912-31184934 GGATCCCGCTCCGGGGCTGCAGG + Intergenic
971812025 4:31439069-31439091 TGGACCCGCACGGGGGCTGCAGG - Intergenic
971905117 4:32716168-32716190 GGCTCCTGCACCGGGGCTGCAGG + Intergenic
972022713 4:34335583-34335605 GAATCCCACACCAGGGCTGCAGG + Intergenic
972034727 4:34506563-34506585 GGATCCGGCACGGGGGCTTCAGG + Intergenic
972173453 4:36375388-36375410 GGATCCCACACTGGGGCCGCAGG - Intergenic
972360871 4:38324862-38324884 GGATCCTGCACCAGGGCCGCAGG + Intergenic
972392631 4:38627320-38627342 GGATCCCGCACTGCCCCTGCAGG - Intergenic
972505715 4:39718457-39718479 GGATCTCGCACCGGGGCCACAGG + Intronic
972900200 4:43672775-43672797 GGATCCCGCACCAGGGCTGCAGG - Intergenic
973037177 4:45420568-45420590 GGATCCCGCACAGGTGCTGCAGG - Intergenic
973039867 4:45457060-45457082 GGATCCTGCACCGGGGCTGCAGG + Intergenic
973041732 4:45477294-45477316 GGATCCTGCACCGGGGCCGCAGG + Intergenic
973045460 4:45530870-45530892 GGATCCCGCACCAGGGCTGCGGG - Intergenic
973146398 4:46831465-46831487 GGATCCCGCACTGGGGCCACAGG - Intronic
973190240 4:47377986-47378008 GGATCTCGCACTGGGGCTGCAGG + Intronic
973308149 4:48675758-48675780 GGATCCTGCACAGGGGCTGCAGG - Intronic
973322836 4:48827799-48827821 GGATCCCATGCCGGGGCTGCAGG - Intronic
973587687 4:52409688-52409710 GGATCCCGCACCAGGGCTGCAGG + Intergenic
973817659 4:54632953-54632975 GGATCCCGCACTGGGGCTGCAGG - Intergenic
973854178 4:54993887-54993909 GGATCCTGCACCGGGGCCACAGG - Intergenic
974089817 4:57300114-57300136 GGATCCTGCACCAGGGCTGCTGG + Intergenic
974128888 4:57729715-57729737 GGATCCCACACCTGGGCCGCAGG + Intergenic
974147493 4:57965842-57965864 GGATCCCGCACTGGGGCTGCAGG - Intergenic
974186862 4:58457346-58457368 GGATCCCCCACTGGGGCTGTGGG - Intergenic
974299172 4:60042165-60042187 GGATCCCGCACCAGGGCTGTGGG + Intergenic
974484711 4:62491840-62491862 GGATCCTGCACCTGGGCTGCAGG + Intergenic
974641672 4:64640416-64640438 GGATCCCGCATGGGGGCTGCAGG + Intergenic
974781666 4:66561435-66561457 GGATCCCACACCAGGGCTGTAGG + Intergenic
974804462 4:66860586-66860608 GGATCCCGCACCGGGGCTGCAGG - Intergenic
974827833 4:67152297-67152319 GGATCCCGCACAGGGGCTGCAGG - Intergenic
974992799 4:69115183-69115205 GGATCCCACACTGGGGTCGCAGG + Intronic
975055473 4:69924308-69924330 GGATCCCACACTGGGGCTGCAGG - Intergenic
975298883 4:72766273-72766295 GGATCCCGCAGGGGGTCTGCAGG - Intergenic
975595112 4:76043237-76043259 GGATCCCGCACCAGGGCTGCAGG + Intronic
975596290 4:76050599-76050621 GGATCCCGCACCAGGGCTGCAGG + Intronic
975995000 4:80303211-80303233 GGCTCCCGCACTGGGGCAGCAGG - Intronic
976102564 4:81580868-81580890 GGATCCCACACCGGGGCTGCAGG - Intronic
976406454 4:84665116-84665138 GGATCCTGCACGGGGGCTGCAGG - Intergenic
976520557 4:86021550-86021572 GGATCCCGTACCAGGGCTGCAGG + Intronic
976646797 4:87395889-87395911 GGATCCCGCACAGGGGCTGCAGG + Intergenic
976736231 4:88313146-88313168 GGATCCCGCACTGGGGCCGCAGG + Intergenic
976846133 4:89490422-89490444 GGATCCCGCACGGAGGCTGCAGG - Intergenic
976980222 4:91217913-91217935 GGATCCCGCACCGGGGCTGCAGG + Intronic
977206600 4:94170261-94170283 GGATCCCCTACTGGGGCCGCAGG - Intergenic
977416730 4:96742936-96742958 GGATCCCGCACTGGAGCCGCAGG - Intergenic
977470625 4:97438025-97438047 GGATCCCGCACCGGGGCCACAGG + Intronic
977507765 4:97923438-97923460 GGATCCAGCACTGGGGCCACAGG - Intronic
977606845 4:98993424-98993446 GGTTCCCGCACTGGGGCCGCAGG + Intergenic
977714163 4:100162407-100162429 AGTTCCCGGCCAGGGGCTGCAGG + Intergenic
977717275 4:100196463-100196485 GGATCCCGAACCAGGGCTGCAGG + Intergenic
977750889 4:100608708-100608730 GGATCCCGCACCGGGGCTGCAGG + Intronic
977883670 4:102234756-102234778 GGATCCCATGCAGGGGCAGCAGG - Intergenic
977906551 4:102483546-102483568 GCATCCTGCACTGGGGCTGCAGG - Intergenic
978207122 4:106092342-106092364 GGATCCCACACTGGGGCCGCAGG + Intronic
978241811 4:106525287-106525309 GGATCCCTCACTGGGGCTGCAGG + Intergenic
978285658 4:107073611-107073633 GGATCCCTCACCAGGGATGCAGG - Intronic
978463549 4:108984334-108984356 GGATCCCGCACAGGGGCTGCAGG + Intronic
978917906 4:114148523-114148545 GGATCCTGCACTGGGGCCGCAGG + Intergenic
978997970 4:115179374-115179396 GAATCTCACACTGGGGCTGCAGG + Intergenic
978999505 4:115200137-115200159 GGATCCCGCACTGGGGCTGCAGG + Intergenic
979308396 4:119174203-119174225 GGATCCCGCACCAGGGCTGCAGG - Intronic
979424679 4:120550680-120550702 GGATCCCGCACTGGGGTTGCAGG + Intergenic
979609092 4:122670632-122670654 GGATCCGGCACTGGGGCCACAGG - Intergenic
979688668 4:123538334-123538356 GGATCCCGCACCTGGGCTGCAGG - Intergenic
979755940 4:124339429-124339451 GGATCCCGCACCAGGGCTGCAGG - Intergenic
979822622 4:125192319-125192341 GGATCCCTCACAGGGGCTGCAGG - Intergenic
979825631 4:125229525-125229547 GGATCCCGCACTGGGGCTGCAGG + Intergenic
979857440 4:125651706-125651728 GGATCCCACACCGGGGGTGCAGG + Intergenic
979899631 4:126201234-126201256 GGATCCCGCACCGGGGCTGCAGG + Intergenic
979949445 4:126874398-126874420 GGATCCTGCACCAGGGCTGCAGG + Intergenic
979991539 4:127380358-127380380 GGATCCCGCACCAGGGCTGCAGG - Intergenic
980043304 4:127964180-127964202 GGATCCCGCACCGGGGCTGCAGG + Intronic
980051856 4:128047502-128047524 GGATCCCGCAGCGGGGCTGCAGG + Intergenic
980228055 4:130013197-130013219 GGATCCGGCAGCGGGGCTGCAGG - Intergenic
980230183 4:130038489-130038511 GGATCCGGCAGTGGGGCTGCAGG + Intergenic
980470153 4:133240350-133240372 GGATCCCACACCGGGGCTGCAGG + Intergenic
980595361 4:134948094-134948116 GGATCCTGCACCAGGGCAGCGGG + Intergenic
980628667 4:135407036-135407058 AGATCCCGCACCGGGGCTGCAGG - Intergenic
980739333 4:136929412-136929434 GGATCCCACACCGGGGCCGCAGG - Intergenic
980799836 4:137734153-137734175 GGATCCCGCACTGGGGCCGCAGG - Intergenic
980815631 4:137942488-137942510 GGATCCCGCACCGGGGCTGCAGG - Intergenic
981136272 4:141213964-141213986 GGATCCCACGCTGGGGCCGCGGG - Intergenic
981176516 4:141689801-141689823 GGATCCCACACTGGGGCTGCAGG + Intronic
981275889 4:142897915-142897937 GAATCCCACACCGGGGTTGCAGG - Intergenic
981280674 4:142954678-142954700 GGATCCTGCGCTGGGGCCGCGGG - Intergenic
982408301 4:155044720-155044742 GGATCCCACACCAGGGCTGCAGG - Intergenic
982647737 4:158044544-158044566 GGATCCCGCACCCGGGCAGCCGG - Intergenic
982692840 4:158567317-158567339 GGATCGCTCACAGGGGCTGCAGG - Intronic
982728263 4:158928119-158928141 GGATCCCACACCTGTGCTGCAGG - Intronic
982814506 4:159868975-159868997 GGATCCCGCACCGGGGCTGCAGG + Intergenic
982868728 4:160550051-160550073 GGATCCTGCACCGGGGCTGCAGG + Intergenic
983026170 4:162739958-162739980 GGATCCCACACCAGGGCTGCAGG - Intergenic
983064014 4:163189657-163189679 GGATCTCGCACCCGGGCTGCAGG + Intergenic
983135012 4:164068771-164068793 GGATCCCTCACCAGGGCCGCAGG - Intronic
983230588 4:165125883-165125905 GGATCCCGCACGGCGGCTGCAGG + Intronic
983290598 4:165799340-165799362 GGATCCTGCACCAGGGCAGCAGG + Intergenic
983552983 4:169035779-169035801 GGATCCCACATCCGGGCTGCAGG + Intergenic
983752920 4:171298698-171298720 GGATCCCGCACCGGGGTTGCAGG - Intergenic
983834165 4:172369424-172369446 GGATCCCGTGCCAGGGCTGCGGG + Intronic
984069363 4:175092531-175092553 GGATCCCGCACCTGGGCTGCAGG - Intergenic
984192757 4:176625107-176625129 GGATCCCGCACCAGGGATGCAGG + Intergenic
984238743 4:177193139-177193161 GGATCCCGCACCTGGGCTGCAGG + Intergenic
984241768 4:177227508-177227530 GGATCCTGCACCGGGGCTGCAGG + Intergenic
984265737 4:177496009-177496031 GGATCCCGCACAGGGGCTGCAGG - Intergenic
984662323 4:182386967-182386989 GGATCCCGCACAGGGGCTGCAGG - Intronic
984728724 4:183045483-183045505 GGATCCTGCACTGGGGCTGCAGG - Intergenic
984770639 4:183433562-183433584 GGATCCTGCACCGGGGCTGCAGG - Intergenic
984776033 4:183482631-183482653 GGATCCCCCACCGGGGCTGCAGG + Intergenic
984901821 4:184592284-184592306 GGATCCCGCACCAGGGCCGCAGG - Intergenic
984918180 4:184741621-184741643 GGATCCCACACCAGGGCTGCAGG - Intergenic
984948644 4:184990030-184990052 GGATCCTGCACCAGGGCTGCAGG + Intergenic
985145498 4:186890532-186890554 GGATCTCACACCGGGGCCGCAGG - Intergenic
985195040 4:187420565-187420587 GGATCCCACACTGGGGCTGCAGG + Intergenic
985203325 4:187506048-187506070 GGATCCCGCACAGGGGCTGCAGG - Intergenic
985366475 4:189236723-189236745 GGATCCCGCACAAGGACTGCAGG - Intergenic
985403529 4:189615149-189615171 GGATCCTGCACTGGGGAGGCAGG + Intergenic
985403794 4:189616589-189616611 GGATCCCGCACAGGGGCTGCAGG + Intergenic
985412034 4:189695632-189695654 GGATCCTGCACCAGGGCCGCAGG + Intergenic
985620102 5:949920-949942 GGATCCTGCACAGGGTCCTCAGG - Intergenic
985654039 5:1120749-1120771 TGATCTCGCACGTGGGCTGCAGG + Intergenic
985827507 5:2203943-2203965 AGATGCAGCACAGGGCCTGCTGG - Intergenic
985926956 5:3026386-3026408 GGATCCCACATAGGGGCACCAGG - Intergenic
986121217 5:4837951-4837973 GGATCCCACACCGGGGCCGCAGG - Intergenic
986233517 5:5887050-5887072 GGAGCGGGCACACGGGCTGCGGG - Intergenic
986340846 5:6788158-6788180 GGAACCTGCCCAGGGGCTGCAGG + Intergenic
986349882 5:6867465-6867487 GGATCACGCCCGGGGGCTGGGGG - Intergenic
986626251 5:9725745-9725767 GGATCCCGCACTGGAGCTGCAGG - Intergenic
986661830 5:10065921-10065943 GGATCCCGCACCCGGGCCGCAGG - Intergenic
986698071 5:10375574-10375596 GGATCCCGCACCCGGGCTGCAGG - Intronic
986826396 5:11527418-11527440 GCATCCCGCACAAGGCCTTCTGG + Intronic
986963662 5:13244603-13244625 GGATCCCACGCTGGGGCTGCAGG - Intergenic
987146176 5:14993747-14993769 GGATCCCACACCGGGGCTGCAGG + Intergenic
987156687 5:15096458-15096480 GGATCCCGCACCAGGGCTGCAGG + Intergenic
987283807 5:16436598-16436620 GGATCCCGCACCAGGGCCGCAGG - Intergenic
987315366 5:16718369-16718391 GGATCCCGCACCAGGGCTGCAGG - Intronic
987347368 5:16990924-16990946 GGATCCCGCACTGGGGCCGCAGG + Intergenic
987383936 5:17311716-17311738 GGATCCTGCACCGGGGCTGCAGG + Intergenic
987532706 5:19142713-19142735 GGATCCCGCACCGGGGCTGCAGG + Intergenic
987877022 5:23691542-23691564 GGATCCCGCACTGGGGCTGCAGG - Intergenic
987896367 5:23951714-23951736 GGATCCCTCACCGGGGCTGCAGG - Exonic
987990176 5:25199965-25199987 GGATCCCACAGAGGGGCTGCAGG + Intergenic
988073581 5:26324878-26324900 GGATCCCGCACCGGGGCTGCAGG - Intergenic
988086913 5:26485223-26485245 GGATCCCGCATGGGGGCTGCAGG + Intergenic
988132235 5:27120317-27120339 GGATCCCACACCGGGGCTGCAGG - Intronic
988154980 5:27439393-27439415 GGATCCTGCACCGGGGCTGCAGG + Intergenic
988177345 5:27743878-27743900 GGATCCCACACCAGGGCTGCAGG - Intergenic
988279488 5:29127566-29127588 GGATTCCGCATTGGGGCTGCAGG + Intergenic
988291692 5:29296435-29296457 GGATCCCCCACTGGGGCCGCAGG + Intergenic
988489072 5:31691956-31691978 GGATCCCACACCAGGGCTGCAGG + Intronic
988684663 5:33515331-33515353 GGATCCCACACAGGGGCTGCAGG + Intergenic
988883669 5:35532045-35532067 GGATCCTGCACTGGGGCTGCAGG - Intergenic
988915824 5:35892810-35892832 GGATCCCGCACTGGGGTTGCAGG + Intergenic
989003277 5:36782998-36783020 GGATCCCACACCGGGGCTGCAGG - Intergenic
989346869 5:40439077-40439099 GGATCCCGCACCGGGGCTGCAGG - Intergenic
989956923 5:50369855-50369877 GGATCCCACACCGGGGCTGCAGG - Intergenic
989958000 5:50377248-50377270 GGATCCTGCACTGAGGCTGCAGG - Intergenic
989965895 5:50465431-50465453 GGATCCTGCACCAGGGCTGCAGG - Intergenic
990419040 5:55613768-55613790 GGATCCTGCACGGGGGCCACAGG - Intergenic
990461596 5:56035907-56035929 GGATCCCGCACCAGGGCTGCAGG - Intergenic
990490139 5:56295742-56295764 GGATCCCTCACAGGGGCTGCAGG - Intergenic
990510894 5:56488082-56488104 GGATCCCGCACCAGGGCCCCGGG - Intergenic
990880294 5:60530715-60530737 GGATCCCGCACGGGGGCCGCAGG - Intergenic
991215020 5:64150488-64150510 GGATCTCGCACCAGGGCTGCAGG - Intergenic
991330163 5:65485421-65485443 GGATCCCGCACCGGGGCTGCAGG + Intergenic
991567487 5:68020345-68020367 GGATCCCGTACGGCGGCTGCAGG + Intergenic
992296810 5:75334103-75334125 GGATCCTGCACCAGGGCTGCAGG - Intergenic
992947522 5:81824131-81824153 GGATCCCGCACCAGGGCTGCAGG - Intergenic
993031948 5:82715107-82715129 GGATCCCGCACTGGGGCTGCAGG - Intergenic
993320859 5:86466624-86466646 GGATCCCACACCGGGGCTGCAGG + Intergenic
993328496 5:86569464-86569486 TGAATCCGCACGGGGGCTGCAGG + Intergenic
993529113 5:89003567-89003589 GGATCCCGCACCGGGGTCGCAGG + Intergenic
993678532 5:90847460-90847482 GGATCCCGCACCAGGGCTGCAGG + Intronic
993803466 5:92374836-92374858 GGATTCCACACTGGGGCTGCAGG + Intergenic
993822115 5:92631749-92631771 GGATCCCACACTGGGGCTGCAGG - Intergenic
994096418 5:95851584-95851606 GGATCCCGCACCTGGGCTGCAGG - Intergenic
994167074 5:96618878-96618900 GGATCCTGTGCCGGGGCTGCGGG - Intronic
994230037 5:97301566-97301588 GGATCCTGCACTGGGGCTGCAGG - Intergenic
994251437 5:97541819-97541841 GGATCCTGCACCAGGGCCGCAGG + Intergenic
994254720 5:97579937-97579959 GGATCCCGCACCGGGGCTGCAGG + Intergenic
994507190 5:100657180-100657202 GGATCCTGCAGGGGGGCTGCAGG - Intergenic
994509766 5:100688810-100688832 GGATCCCGCACGGGGGCTGCAGG + Intergenic
994570373 5:101506446-101506468 GGATCCTGCACCAGGGCTGCGGG - Intergenic
994605531 5:101962388-101962410 GGATCCCGCACAGGGGCTGCAGG + Intergenic
994647689 5:102491334-102491356 GGATCCCCTACCGGGGCCGCAGG + Intronic
994701628 5:103141977-103141999 GGATCCCGCACCAGGGCTGCAGG + Intronic
994769715 5:103966269-103966291 GGATCTCGCACTGGGGCTGCAGG + Intergenic
994841467 5:104929419-104929441 GGATCCCGCACCGGGGCCACAGG - Intergenic
994928878 5:106154675-106154697 GGATCCCGCACAGGGGCTGTAGG - Intergenic
994935352 5:106246628-106246650 GGATCCCGCACCGGGGCTGCAGG - Intergenic
995326346 5:110893970-110893992 GGATCCCGCACGGGGGCTGCAGG + Intergenic
995388258 5:111612094-111612116 GGATCCCGCACCAGGGCTGCAGG + Intergenic
995568744 5:113457561-113457583 GGATCCTGCACCTGGGCTGCAGG - Intronic
995596384 5:113753061-113753083 GGATCCTGCACCGGGGCTGCAGG + Intergenic
995656579 5:114433098-114433120 GGATCCTGCACAGGGGCTGCAGG - Intronic
995679796 5:114704231-114704253 GGATCCCGCACTGGGGCTGCAGG + Intergenic
995700473 5:114929325-114929347 GGATCCCACACCGGGGCTGCAGG - Intergenic
995920471 5:117305080-117305102 GGATCCCGCACCTGGGCTGCAGG - Intergenic
995975904 5:118034243-118034265 GGATCCCACACTGGGACCGCAGG - Intergenic
996107118 5:119517522-119517544 GGATCCCACACCAGGGCTGCAGG - Intronic
996234295 5:121107594-121107616 GGATCCCGCAGCGGGGCTGCAGG - Intergenic
996435773 5:123430972-123430994 GGATCCCGCACCGGGGCTGCAGG - Intergenic
996478625 5:123949132-123949154 GGATCCCGCACTGGGGCCGCAGG + Intergenic
996575818 5:124976061-124976083 GGATCCCACACTGGGGCCACGGG + Intergenic
996586059 5:125089076-125089098 GGATCCTGCACCAGGGCTGCTGG - Intergenic
997158122 5:131579979-131580001 GGACCCAGCACCAGGGCTGCGGG + Intronic
997352285 5:133239377-133239399 GGATCCTGCACCAGGTCTGCAGG - Intronic
997760637 5:136444632-136444654 GGATCCCGCACCGGGGCTGCAGG - Intergenic
997964510 5:138346805-138346827 GGAACCCCCAGTGGGGCTGCAGG - Exonic
998469796 5:142374847-142374869 GGAGCCCACTCAGGAGCTGCAGG + Intergenic
998549830 5:143066834-143066856 TGAGCCAGCACAGGGGCAGCTGG + Intronic
999406258 5:151309610-151309632 GGATCCCACACCGGGGATGCAGG - Intergenic
999855208 5:155586695-155586717 GGATCCCGCACGGGGGCTGCAGG + Intergenic
1000066109 5:157694256-157694278 GGATGCCACACTGGGGCTGCAGG - Intergenic
1000084821 5:157879695-157879717 GGATCCCACACCGAGGCCGCAGG - Intergenic
1000085943 5:157887261-157887283 GGATCCCGCGCTGGGGCCACGGG - Intergenic
1000212427 5:159119548-159119570 GGATCCCGCACCAGGGCCACAGG - Intergenic
1000329113 5:160193839-160193861 GGATCCCGCACCAGGGTTGCAGG + Intronic
1000432301 5:161166100-161166122 AGATCCCACACAGGGGTCGCAGG + Intergenic
1000547686 5:162622262-162622284 GGATCCCGCACTGGGGCCACAGG - Intergenic
1000568646 5:162882889-162882911 GGATCCCGTGCCAGGGCTGCGGG - Intergenic
1000609209 5:163356231-163356253 GGATCCTGCATGGGGGCTGCAGG - Intergenic
1000891741 5:166810138-166810160 GGATCTCGCACAGGGGCTGCAGG + Intergenic
1001843636 5:174901935-174901957 GGATCCTGCACTGAGGCTGCAGG - Intergenic
1002004561 5:176221968-176221990 GGATCCCGCACCGGGGCTGCAGG + Intergenic
1002221814 5:177688652-177688674 GGATCCCGCACTGGGGCTGCAGG - Intergenic
1002308153 5:178296488-178296510 GGATCCCACGCAGGGGCTGCTGG + Intronic
1002616526 5:180459592-180459614 GGATCTTGCACAGGGGCCGCAGG - Intergenic
1002789304 6:426143-426165 GGATCCCGCACCGGGGCTGCAGG + Intergenic
1002793273 6:450386-450408 GGATCTCACACTGGGGCCGCAGG - Intergenic
1002906952 6:1456913-1456935 GGATCCCCTACCGGGGCTGCAGG + Intergenic
1003060799 6:2860558-2860580 GGACCCCACACTGGGGGTGCAGG - Intergenic
1003069747 6:2936236-2936258 GGATCTCGCACTGGGGCCGTGGG - Intergenic
1003070286 6:2940011-2940033 GGATCCTGTACTGGGGCTGCAGG - Intergenic
1003100268 6:3171182-3171204 GGATCCTGTACCGGGGCTGCAGG - Intergenic
1003157026 6:3605407-3605429 GGAACCGGCAGAGAGGCTGCAGG + Intergenic
1003170778 6:3720708-3720730 GGATCCCACACTGGGGCTGCAGG + Intergenic
1003213811 6:4090508-4090530 GGATCCCATACCGGGGCCGCAGG - Intronic
1003224394 6:4191230-4191252 GGATCTCGTACCAGGGCTGCAGG + Intergenic
1003284778 6:4725272-4725294 GGATCCCGCACCGAGGGTGCAGG + Intronic
1003489157 6:6606415-6606437 GGATCCTGCACCTGGGCGGCAGG + Intronic
1003489971 6:6613220-6613242 GGATCCGGCACTAGGGCCGCAGG + Intronic
1003508767 6:6762423-6762445 GGATCTCGCACTGGGGCTGCAGG + Intergenic
1003578101 6:7315593-7315615 GGAACCCGTACTGGGGCTGCAGG - Intronic
1003578248 6:7316766-7316788 GGATCCCACACCGGGGCTGCAGG + Intronic
1003581513 6:7344633-7344655 GGATCCGGCACCGGGGCTGCAGG - Intronic
1003593782 6:7456737-7456759 GCATCCCGCACCCGGGCCGCAGG - Intergenic
1003671613 6:8164751-8164773 GGATCTGGCACCGGGGCTGCAGG - Intergenic
1003717777 6:8666386-8666408 GGATCCCACACCGGGGCTGCAGG - Intergenic
1003736971 6:8887583-8887605 GGATCCCGCACCGGGGCTGCAGG - Intergenic
1003748087 6:9024684-9024706 GGGTCCCGCACGGGGGCTGCAGG - Intergenic
1003749631 6:9041108-9041130 GGATTTCGCACTGGTGCTGCAGG - Intergenic
1003770076 6:9290386-9290408 GGATTCCGCACAGGGGCTGCAGG + Intergenic
1003824994 6:9942611-9942633 GGATCTCGCACCGGGGTGGCAGG - Intronic
1003836139 6:10074653-10074675 GGATCCCGCACCAGAGCCGCAGG + Intronic
1003845808 6:10172172-10172194 GGATCCCGCACCTGGGCTGCAGG - Intronic
1003862867 6:10337829-10337851 GGATCCCGCACCGGGGCTGCAGG - Intergenic
1003896949 6:10617002-10617024 GGATCCCGCACCAGGGCCGCAGG + Intronic
1003901667 6:10660307-10660329 GGATCCCGCACTGGGGCCGCAGG - Intergenic
1003908205 6:10721007-10721029 GGATCCCACACCAGGGCTGCAGG - Intergenic
1004037045 6:11933499-11933521 GGATCCCGCACCGGGGCTGCAGG - Intergenic
1004045293 6:12017874-12017896 GGATCCCGCACTGGGGCCACAGG + Intronic
1004224466 6:13772907-13772929 GGATCCCGCATAGGTGCTGCAGG - Intergenic
1004234342 6:13860561-13860583 GGATCTCCCACTGGGGCCGCAGG - Intergenic
1004250378 6:14018414-14018436 GGATCTCGCACTGGGGCCGCAGG - Intergenic
1004338148 6:14783546-14783568 GGATCCCACACCTGGGCCGCAGG + Intergenic
1004486201 6:16069143-16069165 AGATGCCGCACAGGGGCTGCAGG + Intergenic
1004499596 6:16198042-16198064 GGATCTCGCACCGGGGCCCCCGG + Intergenic
1004501964 6:16217246-16217268 GGGTCCTGCACTGGGGCTGCAGG - Intergenic
1004502083 6:16218163-16218185 GGATCGCACACCGGGGTTGCTGG + Intergenic
1004503115 6:16226811-16226833 GCATCCCGCACTGGGGCTGCAGG + Intergenic
1004665460 6:17745250-17745272 GGATCCCGCACCGGAGCTGCAGG + Intergenic
1004689020 6:17976137-17976159 GGATCCCGCACCGGGGCTGCAGG + Intronic
1004694254 6:18019619-18019641 GGATCCCGCACCGGGGCCGCAGG + Intergenic
1004861314 6:19806953-19806975 GGATCCCGCACTGGGGCCGCAGG + Intergenic
1004865978 6:19854376-19854398 GGATCCCGCACCGGGGCTGCAGG + Intergenic
1004906280 6:20239431-20239453 GGATCCGGCACCGGGGCCGCAGG - Intergenic
1004906863 6:20244713-20244735 GGATCCCGCACCAGGGCTCCAGG + Intergenic
1004912695 6:20301670-20301692 GGATCCTGCACTGGGGCTGCAGG - Intergenic
1005035496 6:21552225-21552247 GGATCCCGCACCGGGGCTGCAGG + Intergenic
1005042196 6:21609842-21609864 GGATCCCACACCAGGGCTGCAGG + Intergenic
1005117644 6:22356341-22356363 GGATCCTGCACCAGGGCCGCAGG + Intergenic
1005332805 6:24765878-24765900 GGATCCCGCGCCGGGGCTGCAGG + Intergenic
1005561504 6:27045651-27045673 GGATCCCGCACTGGGGCCGCAGG - Intergenic
1005600792 6:27424770-27424792 GGACCCCGCGCTGGGGCTGCAGG + Intergenic
1005707376 6:28469296-28469318 GGATCCCGCACTGGGGCTGCAGG + Intergenic
1005724991 6:28639727-28639749 GAATCCCGCACCAGGGATGCAGG + Intergenic
1005749850 6:28872534-28872556 GGATTCCGCACTGGGGCTGCAGG + Intergenic
1005751229 6:28885077-28885099 GGATCCCGCACTGGGGCCACGGG + Intergenic
1005758819 6:28949736-28949758 GGATCCCGCACCGGGGTTGCAGG + Intergenic
1005759879 6:28958262-28958284 GGATCCTGCACCGGGGCTGTAGG - Intergenic
1005766392 6:29015498-29015520 GGATCCTGCACCCGGGCCGCAGG - Intergenic
1005976933 6:30807384-30807406 GGACCCCACACTGGGGCTGCAGG + Intergenic
1005978157 6:30816240-30816262 GGATCCAGCACCGGGGCTGCAGG + Intergenic
1006005849 6:31000883-31000905 GGATCCCGCACCGGGGCTGCAGG - Intergenic
1006008386 6:31021138-31021160 GGATCCCGCCCCGGGGCCGCAGG - Intronic
1006033710 6:31195879-31195901 GGATCCCGCACCGGGGCTGCAGG - Intergenic
1006128026 6:31852433-31852455 GGATCCCGCACTGGGGCCGCAGG - Intergenic
1006226994 6:32547866-32547888 GGATCCCGCACCAGGGCTGCAGG + Intergenic
1006352717 6:33532808-33532830 GGATCCCGCACTGGGGCTGCAGG - Intergenic
1006477907 6:34269444-34269466 GGATCCCGCACCGGGGCTGCAGG - Intergenic
1006696083 6:35931688-35931710 GGATCCCGCACTGGGGCTGCAGG - Intergenic
1006748824 6:36364174-36364196 GGATCCTGCACTGGGGCTGCAGG + Intronic
1006978289 6:38124271-38124293 GGATACCGCACTGGAGCCGCAGG + Intronic
1007738800 6:43998474-43998496 GGATCCTGCACCAGGGCTGCAGG - Intergenic
1008005517 6:46405709-46405731 AGATCTCGCACCGGGGCTGCAGG + Intronic
1008254142 6:49275861-49275883 GGATCCCACACCGGGGCTGCAGG - Intergenic
1008270112 6:49481769-49481791 GGAGCCCACACTGGGGCTGCAGG + Intronic
1008270421 6:49483364-49483386 GGATCCCACACTGGGGCTGCAGG + Intronic
1008284263 6:49629491-49629513 GGATCCCGCACCAGGCATGCAGG + Intronic
1008567899 6:52786902-52786924 GGATCCCACACCGGGGCTGCAGG - Intergenic
1008771072 6:54979654-54979676 GGATCCCGCACCAGGGCTGCAGG - Intergenic
1009470342 6:64024152-64024174 GGATCCCGCACCAGGGCTGCAGG - Intronic
1009510737 6:64547668-64547690 GGATCCCATACTGGGGCTGCAGG + Intronic
1009587721 6:65627959-65627981 GGATCCCGCACCGGGGCTGCAGG - Intronic
1009800785 6:68533808-68533830 GGATCTGGCACTGGGGCTGCAGG - Intergenic
1009872343 6:69467628-69467650 GGATCCCACACCAGGGCCGCAGG - Intergenic
1010199238 6:73268816-73268838 GGATCCTGCACCAGGGCTGCAGG + Intronic
1010235570 6:73572474-73572496 GGATCCCGCACTGGGGGGGCAGG + Intergenic
1010277885 6:73990609-73990631 GGATCAGGCACCAGGGCTGCAGG + Intergenic
1010617459 6:78030220-78030242 GGATCCCGCACCGGGGCTGCAGG - Intergenic
1011143766 6:84189786-84189808 GGATCCCGCACCGGGGCTGCAGG - Intronic
1011178185 6:84587809-84587831 GGATCCCGCATTGGGGCTGCAGG - Intergenic
1011246594 6:85326386-85326408 GGATCCCGCACCAGGGCTGCAGG - Intergenic
1011338281 6:86284761-86284783 GGATCCCGCACCAGAACTGCAGG + Intergenic
1011601660 6:89065331-89065353 GGATCCCGCACCGGGGCTGTAGG - Intergenic
1011618642 6:89221311-89221333 TGCTCCCAAACAGGGGCTGCAGG + Intronic
1011620028 6:89234431-89234453 GGATCCTGCACCAGGGCTGCAGG + Intergenic
1011870010 6:91881836-91881858 GGATCCCGCACCCGGGCTGCAGG + Intergenic
1011974834 6:93283023-93283045 GGATCCCGCACCGGGGCCGCAGG - Intronic
1012189267 6:96260888-96260910 GGATCCCACACAGGGGCCGCAGG + Intergenic
1012578156 6:100829174-100829196 GGATCCCGCACCTGGGCTGCAGG + Intronic
1012733486 6:102910662-102910684 GGATCCCACACTGGGGCCGCAGG + Intergenic
1012760427 6:103294346-103294368 GGATCCCGCACCGGGGCTGCAGG + Intergenic
1013080301 6:106806174-106806196 GGGTCCCGCACCGGGGCTGCAGG - Intergenic
1013081409 6:106816704-106816726 GGATCCCGCACCAGGGCTGCAGG + Intergenic
1013143492 6:107364187-107364209 GGATCCCGCACTGGGGCTGCAGG + Intronic
1013410711 6:109881088-109881110 GGATCCTGCACCGGGGCTGCAGG + Intergenic
1013575937 6:111483408-111483430 CGATCCCGCGCGGGCGCTGCCGG - Intronic
1013853303 6:114541792-114541814 GGATCCTGCACCAGGGCCGCAGG + Intergenic
1013955270 6:115834542-115834564 GGATCCTGCACCCGGGTTGCAGG + Intergenic
1013960152 6:115889464-115889486 GGATCCTGCACTGGGGCCGCAGG - Intergenic
1013963376 6:115928024-115928046 GGATCCCGCACCAGGGCTGCAGG + Intergenic
1014055960 6:117015171-117015193 GGATCTCGCACTGGGGCTGCAGG - Intergenic
1014240818 6:119015742-119015764 GGATCCCGCACCGGGGCTGCAGG - Intronic
1014280879 6:119441422-119441444 GGATCTCGCACTGGGGCTGCAGG - Intergenic
1014460194 6:121686397-121686419 GGATCCCGCACTGGGGCTGCAGG + Intergenic
1014499206 6:122165070-122165092 GGATCCCACACCGGGGCCGCAGG + Intergenic
1014507836 6:122280998-122281020 GGATCCCGCACCTGGGCTACAGG - Intergenic
1014586377 6:123202375-123202397 AGATCCCACACCAGGGCTGCGGG - Intergenic
1014718633 6:124892391-124892413 GGATCCCGCACTAGGGCTGCAGG - Intergenic
1014739078 6:125126272-125126294 GGATCCCGCACTGGGGCTGCAGG - Intronic
1014788548 6:125644871-125644893 GGATCCTGCACCGGGGCTGCAGG - Intergenic
1014920998 6:127214532-127214554 GGATCCGGCACCGGGGCTGCAGG + Intergenic
1015572175 6:134633486-134633508 GGATCCCGCACCGGGGCCACGGG + Intergenic
1015600422 6:134905148-134905170 GGATCCCGCACCAGGGCTGCAGG - Intergenic
1015842343 6:137488899-137488921 GGATCGCTCACAGGGGCTCCGGG + Intergenic
1016067295 6:139697866-139697888 GGATCCTGCACCGGGGCTGCAGG + Intergenic
1016069820 6:139726278-139726300 GGATCCCTCACCGGGGCTGCAGG + Intergenic
1016092753 6:139999526-139999548 GGATCCCGCACTGGAGCTGCAGG + Intergenic
1016172866 6:141041566-141041588 GGATCCCGCACAGGGGCCACGGG + Intergenic
1016217277 6:141618632-141618654 GGATCCTGCACCGGGGCTGCAGG - Intergenic
1016482239 6:144495092-144495114 GGATCCCGCACCCGGGCTGCAGG + Intronic
1016914192 6:149229593-149229615 GGATCCTGCACAGAGTCAGCAGG + Intronic
1017299055 6:152834762-152834784 GGATCCCGCACCGGGGCTGCAGG - Intergenic
1017325168 6:153134040-153134062 GGATCCCGTACTGGGGCTGCAGG - Intergenic
1017581140 6:155866697-155866719 GGATCCCGCACCGGGGCTGCAGG + Intergenic
1017839418 6:158209693-158209715 GATCCCCGCACCGGGGCTGCAGG + Intergenic
1018064161 6:160114459-160114481 GGATCCCACACCGGGGCTGCAGG + Intergenic
1018545743 6:164933715-164933737 GGATCCCGCACCCGGGCTGCAGG - Intergenic
1018624572 6:165765229-165765251 GGATCCCGCACGGGGGCTGCAGG + Intronic
1018652880 6:166006085-166006107 GGACCCTGCGCAGGAGCTGCCGG + Intergenic
1018696120 6:166393294-166393316 GGATCCTGCACCGGGGCCGCAGG + Intergenic
1018696973 6:166397897-166397919 GGGACCTGCACAGGGGCTGAGGG + Intergenic
1019000189 6:168743726-168743748 GGATCCCGCACCGGGGCTGCAGG + Intergenic
1019497306 7:1346554-1346576 GGGCCCCGCACATGGGCTGAGGG - Intergenic
1019795233 7:3043787-3043809 GCCGCCCGCCCAGGGGCTGCAGG + Exonic
1019944189 7:4313879-4313901 GGATCCCGCACAGGGGCTGCAGG + Intergenic
1019965678 7:4496872-4496894 GGATCCCGCACAGGGGCTGCAGG + Intergenic
1020008345 7:4793906-4793928 GGATCCTGCACAGGGGCTGCAGG - Intronic
1020163988 7:5793911-5793933 GGATCCCGCACTGGGGCCGCAGG - Intergenic
1020784358 7:12556104-12556126 GGATCCCACACTGGGGCTGCAGG + Intergenic
1021324199 7:19245902-19245924 GGATCCCGCACCTGGGCTGCAGG - Intergenic
1021359333 7:19692193-19692215 GGATCCCACACAGGGGCCGCGGG + Intergenic
1021513728 7:21461140-21461162 GGATTTCGCACCAGGGCTGCAGG + Intronic
1021567453 7:22029057-22029079 GGATCCAGCACTGGGGCCGCAGG - Intergenic
1021567820 7:22032309-22032331 GGATCCCGCACTGGGGCCGCAGG + Intergenic
1022174074 7:27856998-27857020 GGATCCTGCACCAGGGCCGCAGG + Intronic
1022750513 7:33219391-33219413 GGACCCTGCACTGGGGCTGCAGG - Intronic
1023128009 7:36974156-36974178 GGATACCACACCGGGGCTGCAGG - Intronic
1023232530 7:38050004-38050026 GGATCCTGCAGGCGGGCTGCAGG - Intergenic
1023396134 7:39753892-39753914 GGATCTCGCACCTGGGCCGCAGG + Intergenic
1024269153 7:47628895-47628917 GGATCCCGCACCGGGGCTGCAGG - Intergenic
1024335558 7:48202855-48202877 GGATCCCGCACCAGGGCTGCAGG + Intronic
1024443908 7:49454052-49454074 GGATCCTGCACTGGAGCTGCAGG - Intergenic
1024465980 7:49711675-49711697 GGATCCCACACTGGGGCTGCAGG - Intergenic
1024700561 7:51900827-51900849 GGATCTGGCACTGGGGCTGCAGG + Intergenic
1024735739 7:52302836-52302858 GGATCCCGCACAAGGGCCACAGG + Intergenic
1024741842 7:52363025-52363047 GGGTCCCGCACCTGGGCTGCAGG - Intergenic
1024748127 7:52431184-52431206 GGATCCCGCGCCGGGGCCGCAGG + Intergenic
1024825354 7:53385103-53385125 GGATCCCGCACCAGGGCTGCAGG + Intergenic
1024834121 7:53495439-53495461 GGATCCCGCACTGGGGCTGCAGG - Intergenic
1024961424 7:54980879-54980901 GGAGCCCGCAGAGGCGGTGCTGG + Intergenic
1025188103 7:56876581-56876603 GGAGCCCGGGCAGGGGCAGCTGG + Intergenic
1025683820 7:63700341-63700363 GGAGCCCGGGCAGGGGCAGCTGG - Intergenic
1026187019 7:68090356-68090378 GGATCCCACAACGGGGCTGCAGG + Intergenic
1026203020 7:68231450-68231472 GGCTTTCGCACTGGGGCTGCAGG - Intergenic
1026335967 7:69394244-69394266 GGATCCCGCACCGGGGCTGCAGG - Intergenic
1026512416 7:71038013-71038035 GGATCCTGCACCGGGGCTGCAGG - Intergenic
1026516642 7:71078405-71078427 GGATCCCACACCGGGGCTGCAGG - Intergenic
1026596484 7:71738021-71738043 GGATCCCACACCAGGGCTGCAGG + Intergenic
1027561749 7:79739719-79739741 GGATCCCGCACCGGGGCTGCAGG - Intergenic
1027563967 7:79767907-79767929 GAATCCCGCATCGGGGCTGCAGG + Intergenic
1027579640 7:79977546-79977568 GGATCCTGCACTGGGGCTGCAGG + Intergenic
1027665966 7:81043126-81043148 GGATCCTGCACTGGGGCTGCAGG - Intergenic
1027667462 7:81057425-81057447 GGATCCCGCACCAGGGCTGCAGG + Intergenic
1027674552 7:81142156-81142178 GGATCCCGCACCGGGGCCGCAGG - Intergenic
1027698209 7:81437032-81437054 GGATCCCGCACTGGGGCTACAGG + Intergenic
1027779023 7:82499988-82500010 GGATCCCACACTGGGGCTGCAGG - Intergenic
1027868172 7:83673729-83673751 GGATCCCGCACTGGGGCTGCAGG - Intergenic
1028142571 7:87289142-87289164 GGATCCTGCACACGGGCCGCAGG - Intergenic
1028511142 7:91627335-91627357 GGATCCCGCACCAGAGCTGCAGG + Intergenic
1028727238 7:94101253-94101275 GGATCCCGCACTGGGGCCACGGG - Intergenic
1028778397 7:94705911-94705933 GGATCCCGCACCGGGGCTGCAGG - Intergenic
1028852443 7:95552408-95552430 GGATCCCACACCGGGGCTGCAGG + Intergenic
1028913066 7:96229126-96229148 AGATCCCGCACTGGGGCTGCGGG - Intronic
1029076212 7:97936300-97936322 GGATCCCGCACAGGAGCTGCAGG - Intergenic
1029567580 7:101348993-101349015 GAATCCCACACCGGGGCTGCAGG - Intergenic
1029809565 7:103034186-103034208 GGATCTCGCACTGGGGCTGCAGG + Intronic
1029832304 7:103274867-103274889 GGATCCTGCACTGGGGCTGCAGG + Intergenic
1029904027 7:104072178-104072200 GGATTCCGCACTGGGGCTGCAGG - Intergenic
1029988238 7:104940571-104940593 GGATTCTGCACGGGGGCTTCAGG - Intergenic
1030215657 7:107042304-107042326 GGATCCCGCACTGGGGCTGCAGG + Intergenic
1030292722 7:107888236-107888258 GGATCCTGCGCTGGGGCGGCAGG - Intergenic
1030366949 7:108657192-108657214 GGATGCTGCACTGGGGCTGCAGG + Intergenic
1030733563 7:113017764-113017786 GGATCCCGCACCGGGGCTGCAGG - Intergenic
1030780488 7:113593736-113593758 GGATCCCGCACCGGGACTGCAGG - Intergenic
1030819243 7:114076793-114076815 GGATACGGCACCGGGGCTGTAGG + Intergenic
1030980620 7:116181925-116181947 GGATCCCGCACTGGGGCTGCAGG + Intergenic
1031056463 7:116997939-116997961 GGATCCCGCACTGGGGCTGCAGG + Intronic
1031110037 7:117596527-117596549 GGATCCCGCACTGGGGCTGCAGG - Intronic
1031292188 7:119951453-119951475 GGATCCCACACTGGGGGTGCAGG + Intergenic
1031409283 7:121422145-121422167 GGATCCCGCACTGGGGCCACAGG - Intergenic
1031513219 7:122673757-122673779 GGATCCCACACCAGGGCTGCAGG + Intronic
1031902943 7:127429582-127429604 GGATCCTGCACCAGGGCCGCAGG - Intronic
1032248143 7:130230440-130230462 GGATCCCGCACAGGGGCTGCAGG - Intergenic
1032339723 7:131059179-131059201 GGATCCCACACTGGGGATGCAGG - Intergenic
1032561530 7:132898549-132898571 GGATCCCGCACCCAGGCTGCAGG + Intronic
1033065146 7:138146539-138146561 GGATCTCGCACTGGGGCTGCAGG - Intergenic
1033312358 7:140271287-140271309 GGATCCCGCACCCGGGTCGCAGG + Intergenic
1033394022 7:140956897-140956919 GGATCCTGCACTGGGGCTGCAGG + Intergenic
1033664029 7:143424340-143424362 GGATCCCGCACCAGGGCTGTAGG + Intergenic
1033758542 7:144417912-144417934 GGATCCCGCACCAGGGCCGCAGG + Intergenic
1033866573 7:145697355-145697377 GGATCCCGCACCGGGGCCGCAGG + Intergenic
1034091120 7:148364226-148364248 GGATCCCGCACTGGGGCTGCAGG - Intronic
1034097988 7:148426826-148426848 GGATCCCGCACTGGGGCTGCAGG - Intergenic
1034155092 7:148949499-148949521 GGATCCCGCACCGGGGCTGCAGG - Intergenic
1034167683 7:149038641-149038663 GGATCCCACACCGGGGCTGCAGG + Intergenic
1034632068 7:152538830-152538852 GGATCCCGCACCGGGGCTGCAGG + Intergenic
1034655964 7:152730218-152730240 GGATCCCGCACCGGGGCTGCAGG + Intergenic
1034900924 7:154907318-154907340 GGATCCCGTGCTGGGGCCGCGGG - Intergenic
1034965366 7:155387413-155387435 GCCTCCCGCAGAGGGGCTGAGGG + Intronic
1034967025 7:155398087-155398109 GGATCTCGCACTGGGGCTGCAGG + Intergenic
1035151114 7:156873948-156873970 GGATTCCGCACTAGGGCTGCAGG + Intronic
1035201789 7:157272456-157272478 GGTTCCGGCCCAGGTGCTGCGGG - Intergenic
1035325486 7:158062987-158063009 GGATCCTGCACCAGGGCCGCAGG - Intronic
1035999314 8:4583246-4583268 GGGTCCCGCACCACGGCTGCAGG - Intronic
1036123754 8:6045003-6045025 GGATCCCACACGGAGGCTGCAGG + Intergenic
1036172605 8:6503826-6503848 GTGTCCAGCACAGGGGCTGTGGG + Intronic
1036260536 8:7236068-7236090 GGACCCAGCACAGGAGCTGCAGG - Intergenic
1036306077 8:7603454-7603476 GGACCCAGCACAGGAGCTGCAGG + Intergenic
1036312573 8:7694624-7694646 GGACCCAGCACAGGAGCTGCAGG - Intergenic
1036356923 8:8051439-8051461 GGACCCAGCACAGGAGCTGCAGG + Intergenic
1036440955 8:8781334-8781356 GGATCCCGCACCGGGGCTGCAGG + Intergenic
1036650306 8:10637948-10637970 GGACCCAGCCCTGGGGCTGCAGG - Intronic
1036831424 8:12023020-12023042 GGATCCCGCACAAGAGCCGCAGG - Intergenic
1036851242 8:12203328-12203350 GGGTCCCACACGGGGGCCGCAGG + Intergenic
1036901647 8:12673823-12673845 GGATCCCACACAGGAGCCACAGG - Intergenic
1036915050 8:12796681-12796703 GGATCCTGCACCGGGGCTGCAGG - Intergenic
1037239431 8:16760483-16760505 GGATCCCACACCAGGGCTGCAGG + Intergenic
1037241626 8:16784324-16784346 GGATCCCACACCGGGGCTGCAGG - Intergenic
1037263771 8:17036760-17036782 GGATCCCGCACCAGGGCTGCAGG + Intronic
1037425537 8:18750986-18751008 GGATCCCGCACCGGGGCTGCAGG + Intronic
1037559006 8:20055143-20055165 GGATCTCGCACAGGGGCCGCAGG - Intergenic
1037811057 8:22086986-22087008 GGATCCCGCACCGGGGCTGCAGG - Intergenic
1037957474 8:23070723-23070745 GGATCCCGCACCGGGGTTGCAGG + Intergenic
1037971266 8:23173741-23173763 GGATCCCGCACTGGGGCTGCAGG + Intergenic
1037983600 8:23272534-23272556 GGATCCCGCACGGGGGCTGCAGG - Intronic
1038174140 8:25164913-25164935 GGGTCCCGCACCGGGGCTGCAGG - Intergenic
1038638349 8:29304672-29304694 GGATCCTGCACAGGGGCTGCAGG - Intergenic
1038639479 8:29311880-29311902 GGATCCCGCACAGGGGCTGCAGG - Intergenic
1038870770 8:31490285-31490307 GGATCTCGCACTGGGGCTGCTGG - Intergenic
1039061372 8:33574321-33574343 GGATCCCGCACAGGGGCTGCAGG - Intergenic
1039068808 8:33632098-33632120 GAATCCTGCACCGGGGCCGCAGG - Intergenic
1039069034 8:33633770-33633792 GGAACCCGCACTGCGGCTGCAGG + Intergenic
1039284926 8:36029244-36029266 GGATCCTGCACTGGGGCTGCAGG - Intergenic
1039587680 8:38720214-38720236 GGATCGGGCACCGGGGCTGCAGG - Intergenic
1039637378 8:39180545-39180567 GGATCCCGCACCAGGGCTGCAGG - Intronic
1040003619 8:42599999-42600021 GGATCCCACGCCAGGGCTGCAGG + Intergenic
1040014550 8:42689930-42689952 GGATGCCACACCAGGGCTGCAGG - Intergenic
1040026616 8:42787173-42787195 GGATCCCGCACCAGGGCCGCAGG - Intronic
1040106604 8:43545506-43545528 GGGTCCAGCGCAGGGCCTGCCGG + Intergenic
1040275801 8:46013056-46013078 GGATGCCATGCAGGGGCTGCTGG + Intergenic
1040275996 8:46013919-46013941 GGACCCAGCACAGGGGTTGACGG + Intergenic
1040276360 8:46016047-46016069 GGATGCTGTGCAGGGGCTGCCGG + Intergenic
1040276507 8:46016659-46016681 GGGCCCAGCGCAGGGGCTGCTGG + Intergenic
1040276936 8:46018616-46018638 GGACCCCACACAGAGGCTGACGG + Intergenic
1040277337 8:46020779-46020801 GGACCCCGCACAGGGGCTTCTGG + Intergenic
1040277823 8:46022943-46022965 TGGTCCAGCACAGAGGCTGCTGG + Intergenic
1040277971 8:46023595-46023617 GGGCCCAGCATAGGGGCTGCTGG + Intergenic
1040278370 8:46025338-46025360 GGGCCCAGCCCAGGGGCTGCCGG + Intergenic
1040278574 8:46026207-46026229 TGACCCAGCACAGGGGCTGCCGG + Intergenic
1040351345 8:46571943-46571965 GGATCCTGCACTGGGGCCGCAGG - Intergenic
1040389286 8:46935790-46935812 GATTCCCCCACAGAGGCTGCAGG - Intergenic
1040469557 8:47725981-47726003 GGCTCCTGCCCAGGGCCTGCAGG - Intronic
1040622156 8:49102945-49102967 GGATCTCGCACCGGGGCCACAGG + Intergenic
1040723199 8:50350336-50350358 GGATCCCGCACCAGGGCCACAGG - Intronic
1040794237 8:51271652-51271674 GGATCCTGCACTGGGGCCGCAGG - Intergenic
1040889478 8:52302018-52302040 GCTTCCCTCAGAGGGGCTGCGGG + Intronic
1040952637 8:52952799-52952821 GGATCCCGCACCAGGGCTGCAGG + Intergenic
1040954068 8:52961783-52961805 GGATCCCGCACCAGGGCCGCAGG - Intergenic
1040954848 8:52969776-52969798 GGATCTCACACTGGGGCTGCAGG + Intergenic
1041034589 8:53775843-53775865 GGGTCCCGCACTGGGGCTGCAGG + Intronic
1041068608 8:54104613-54104635 GGATCCTGCACTGGGGCCGCAGG - Intergenic
1041914594 8:63126492-63126514 GGATCCCGCACCGGGGCTGCAGG - Intergenic
1041919001 8:63162407-63162429 GGATCCCGCACCAGGGCTGCAGG - Intergenic
1042512499 8:69626427-69626449 GGATCCCGCACAGGGGCTGCAGG + Intronic
1042948682 8:74179474-74179496 GGATCCCGCACAGGGGCCGGAGG + Intergenic
1043073269 8:75665408-75665430 GGATCCCGCACCGGGGCCGCAGG + Intergenic
1043110171 8:76169989-76170011 GGATCATGCACTGGGGCTGCAGG - Intergenic
1043129863 8:76447558-76447580 GGATCCCGCACGGGGACTGCAGG + Intergenic
1043346533 8:79303912-79303934 GGATCCCGCTCCCGGGCTGCAGG - Intergenic
1043352419 8:79377146-79377168 GGATCCCGCACCGGGGCAGCAGG + Intergenic
1043435399 8:80232226-80232248 GGATCCCGCACCGGGCCTGCAGG - Intergenic
1043620967 8:82192199-82192221 GGATCCTGCACCGGGGAGGCAGG + Intergenic
1043640235 8:82441796-82441818 GGATCCCTTACCGGGGCTGCAGG - Intergenic
1043701192 8:83290768-83290790 GGATCCTGCACCGGGGCTGCAGG - Intergenic
1043709957 8:83403364-83403386 GGATCCCACACCGGGGCTGCAGG - Intergenic
1043725923 8:83611104-83611126 GGATCCTGCACCAGGGCTGTGGG + Intergenic
1043857229 8:85276444-85276466 GGATCTCGCACCAGGGCTGCAGG - Intronic
1044075895 8:87821252-87821274 GGATCCTGCACCGGGGCTGCAGG - Intergenic
1044404957 8:91816739-91816761 GGATCCCGCACCTGGGCTGCAGG - Intergenic
1044633401 8:94300276-94300298 GGATCCCACACCGGGGCAGCAGG + Intergenic
1044862085 8:96533789-96533811 GGATCCTGCACTGGGGCCACAGG + Intronic
1044880597 8:96719029-96719051 AGATCCCGCACCGGGGCTGCAGG + Intronic
1045131872 8:99163342-99163364 GGATCCCGCACCGGGGCTGCAGG + Intronic
1045467688 8:102485456-102485478 GGATCCCGCACCAGGGCTGCAGG + Intergenic
1046208816 8:111040780-111040802 GGATCTCGCACTGGGGCTGCAGG + Intergenic
1046265322 8:111823233-111823255 GGATCCCGCACTGGAGCTGCAGG + Intergenic
1046284982 8:112082962-112082984 GGATCCCGCAAGGGGGCTGCAGG + Intergenic
1046445413 8:114311768-114311790 GGATCCCGCACCAGGGCTGCAGG - Intergenic
1046450782 8:114386573-114386595 GGATCCCGCACCAGGGCTGCAGG - Intergenic
1046521323 8:115330509-115330531 GGATCCCACACAGGGGCCACGGG + Intergenic
1046621280 8:116531462-116531484 GGATCCCGCACGGGGCCTGCAGG - Intergenic
1047100118 8:121667388-121667410 AGATCACACACCGGGGCTGCAGG + Intergenic
1047180474 8:122583185-122583207 GTATCCTACACAGGGGCTGGAGG - Intergenic
1047215597 8:122873433-122873455 GGCACCAGCTCAGGGGCTGCAGG - Intronic
1047631629 8:126714580-126714602 GGACCCCGCACTGGGGCCACAGG + Intergenic
1048186820 8:132249601-132249623 GGATCCTGCACCGGGGCCACAGG + Intronic
1048193992 8:132316934-132316956 GGACTCTGGACAGGGGCTGCTGG + Intronic
1048276032 8:133066858-133066880 AGATCCCGTGCAGGGGCTGGGGG + Intronic
1048348849 8:133599609-133599631 GGAACCCCCTCAGAGGCTGCAGG + Intergenic
1048575969 8:135690400-135690422 GGATTCCACACTGGGGCTGCAGG + Intergenic
1048757425 8:137755062-137755084 GGATCCCACACCAGGGCTGCAGG + Intergenic
1048862254 8:138732294-138732316 GGAGCACTCACAGGTGCTGCGGG + Intronic
1049087563 8:140490459-140490481 GGATCCCACACTGGGGCTGCAGG + Intergenic
1049157764 8:141077058-141077080 GGATCCCGCACCGGGGCTGCAGG - Intergenic
1049235408 8:141510107-141510129 GGATCCCCAAGGGGGGCTGCAGG + Intergenic
1049359663 8:142206284-142206306 GGATGCCGGCCAGGAGCTGCCGG - Intergenic
1049500385 8:142959894-142959916 GGATCCCGCACCGGGGCTGCAGG - Intergenic
1049653826 8:143789118-143789140 GGAGCCCGGGCAGGGGGTGCTGG + Intergenic
1049944439 9:580714-580736 GGATCCCGCACTGGGGCCGCAGG + Intronic
1050892074 9:10836374-10836396 GGATCCTGCACGGGGGCCGCAGG - Intergenic
1050920686 9:11197283-11197305 GGATCCTGCACTGGGGCTGCAGG - Intergenic
1051305014 9:15699987-15700009 GGATCCCGCACCCGGGCTGCAGG + Intronic
1051439927 9:17073020-17073042 GGATCCCGCACGGGGGCTGCAGG - Intergenic
1051449328 9:17178355-17178377 GGATCCCGCACCCGGGCCGCAGG + Intronic
1051459272 9:17294625-17294647 GTATCCCGCACAGGGGCCACAGG + Intronic
1051463872 9:17354353-17354375 GGATCCCGCACCGGGGCTGCAGG - Intronic
1051892765 9:21959668-21959690 GGATCCTGCACCAGGGCTGCAGG - Intronic
1052056607 9:23914402-23914424 GGATCCCGCACTGGGGCCGCAGG + Intergenic
1052075519 9:24135484-24135506 GGGTCCTGCACCGGGGCTGCAGG - Intergenic
1052313494 9:27093028-27093050 GGGTCCCCCATCGGGGCTGCAGG - Intergenic
1052979624 9:34438363-34438385 GGATCCCGCACCGGTGCTGCAGG - Intronic
1052985277 9:34482707-34482729 GGATCCCCCACCGGGGCTGCAGG + Intronic
1053027209 9:34740179-34740201 GGATTCCGCACCGGGGCTGCGGG + Intergenic
1053393511 9:37752341-37752363 GGATCCAGCACTGGGGCCGCAGG - Intronic
1053436160 9:38075741-38075763 GGATCCTGTCCCGGGGCTGCAGG - Intergenic
1053547841 9:39042300-39042322 GGATCCCGCACAGGGGCTGCAGG + Intergenic
1053811965 9:41862341-41862363 GGATCCCACACCGGGGCTGCAGG + Intergenic
1053928352 9:43089780-43089802 GGATCCCGCGCTGGGGCCGCTGG - Intergenic
1054285355 9:63163511-63163533 AGATCCCGCGCTGGGGCCGCTGG + Intergenic
1054291447 9:63296973-63296995 AGATCCCGCGCTGGGGCCGCTGG - Intergenic
1054389465 9:64601512-64601534 AGATCCCGCGCTGGGGCCGCTGG - Intergenic
1054618630 9:67325098-67325120 GGATCCCACACCGGGGCTGCAGG - Intergenic
1054722527 9:68617441-68617463 GGATCCGGCACCAGGGCTGCAGG - Intergenic
1055102497 9:72480182-72480204 GGATCCCGCACCAGGGCTGCAGG + Intergenic
1055461390 9:76523671-76523693 GGATCCCACACAGGGGCTGCAGG + Intergenic
1055557511 9:77490327-77490349 GGATCCCACACTGGGGTTGCAGG + Intronic
1055651444 9:78410412-78410434 GGATCCCGCACTGGGGCTGCAGG - Intergenic
1055814082 9:80185234-80185256 GGATCCAGCACCAGGGCCGCAGG + Intergenic
1055985454 9:82054324-82054346 GGATCCTGCACCGGGGCCACAGG + Intergenic
1056506505 9:87263269-87263291 GGATGCCACTCAGGGGCTGACGG + Intergenic
1056736004 9:89209776-89209798 GGATCCCACACCAGTGCTGCAGG - Intergenic
1056743822 9:89282842-89282864 GGATCGCGCACTGGGGCTGCAGG - Intergenic
1056771322 9:89480361-89480383 GGATCCCGCACCGGGGCTGCAGG + Intronic
1057245791 9:93452590-93452612 GGACCCCGAACAGGGACAGCTGG - Exonic
1057383852 9:94591087-94591109 GGATCCCGCACCGGGGCTGCAGG + Intronic
1057470136 9:95349704-95349726 GGACCTTTCACAGGGGCTGCGGG - Intergenic
1057511208 9:95680748-95680770 GGATGCCGCACGGGGGATGCAGG - Intergenic
1057543789 9:96001662-96001684 GGATCCCGCACCGGGGCTGCAGG + Intronic
1057628558 9:96700831-96700853 GGATCCCACACCGGGGCTGCAGG + Intergenic
1057726982 9:97574591-97574613 GGATCCTGCACCGGGGCCGCAGG - Intronic
1057907119 9:98992062-98992084 GGATCCCGCACGAGGGCAGCAGG + Intronic
1058174797 9:101724058-101724080 GGATCCTGCACCGGGGCTGCAGG + Intronic
1058235624 9:102486926-102486948 GGATCCCATACCAGGGCTGCAGG + Intergenic
1058365249 9:104201011-104201033 GGATCCTGCATTGGGGCCGCAGG - Intergenic
1058727603 9:107818219-107818241 GGATCTCACACCGGGGCCGCCGG - Intergenic
1058786570 9:108393930-108393952 GGATCCTGCACCGGGGCTGCAGG - Intergenic
1059492025 9:114675928-114675950 GGATTCAGCTCAGGGGCTACAGG + Intergenic
1059791085 9:117642708-117642730 GGATCCCGCACCGGGGCTGCAGG + Intergenic
1059810686 9:117852402-117852424 GGATCCCACACCGGGGCTGCAGG - Intergenic
1059891379 9:118809202-118809224 GGATCCCGCACCTGGGCGGCAGG + Intergenic
1060091415 9:120746762-120746784 GGATCCCGCACCCGGGCTGCAGG - Intergenic
1060305308 9:122406142-122406164 GGATCCCGCAGCGGGGCCGCAGG + Intergenic
1060594158 9:124838676-124838698 GGATCCCGCACCAGGGCTGCAGG + Intergenic
1061236459 9:129345918-129345940 GGAACCCTCACAGTGGCTCCAGG - Intergenic
1061239084 9:129358774-129358796 GTACCCCACACAGGGGCTGTGGG + Intergenic
1061284817 9:129616157-129616179 GCATCCAGCCCAGGGTCTGCAGG + Intronic
1061481101 9:130898114-130898136 GAATCCCAGGCAGGGGCTGCCGG - Intergenic
1061483902 9:130910539-130910561 GGATCCCGCACCGGGACTGCAGG - Intronic
1061510759 9:131059664-131059686 GCTTCCTCCACAGGGGCTGCAGG - Intronic
1061845607 9:133386486-133386508 GTAAGCTGCACAGGGGCTGCAGG - Intronic
1062146138 9:134990975-134990997 GGATCCCGCACTGGGGCTGCAGG + Intergenic
1062243722 9:135552821-135552843 GGAGCCTGGCCAGGGGCTGCCGG - Intergenic
1062381595 9:136289582-136289604 GGCTCCCCCACAAGGGCTGCAGG + Intronic
1203429865 Un_GL000195v1:80737-80759 GGATCCCCCACAGGGTCTGCAGG - Intergenic
1203460363 Un_GL000220v1:30964-30986 GGATCCCACACCAGGGCCGCAGG + Intergenic
1203662806 Un_KI270753v1:61347-61369 GGATCCTGCACCAGGGCCGCAGG + Intergenic
1203670560 Un_KI270755v1:7349-7371 GGATCCTGCACCAGGGCCGCAGG - Intergenic
1185877877 X:3714275-3714297 GGATCCCCAAGAGGGGCTGCCGG + Intergenic
1186152525 X:6690451-6690473 GGATCCCGCACCGGGGCTGCAGG + Intergenic
1186295582 X:8144914-8144936 GGATCCTGCACTGGGGCCGCAGG + Intergenic
1186323182 X:8452434-8452456 GGATCCCGCACCGGGGCTGCAGG + Intergenic
1187005777 X:15231674-15231696 GGATCCCGTACGAGGGCTGCAGG + Intergenic
1187139124 X:16575869-16575891 GGATCCCGCACTGGGGCTGCAGG - Intergenic
1187304675 X:18084220-18084242 GGATCCCACACTGGGGCTGCAGG - Intergenic
1187557505 X:20366793-20366815 GGATCCCGCACTGGGGCTGCAGG + Intergenic
1187904083 X:24050109-24050131 GGATCCGGCACCGGGGCTGCAGG - Intergenic
1188112070 X:26205176-26205198 GGATCTCCCACTGGGGCTGCAGG - Intergenic
1188166893 X:26873644-26873666 GGATCCCGCACTGGGGCTGCAGG + Intergenic
1188189596 X:27157420-27157442 GGATCCCGCACTGGGGCTGCAGG - Intergenic
1188242747 X:27809708-27809730 GGATCCCGCACTGGGGCCGCAGG - Intronic
1189187920 X:39070143-39070165 GGAACCCGCACCGGCGCTCCCGG + Intergenic
1189209904 X:39275997-39276019 GGATCCCGCACCAGGGCCACAGG - Intergenic
1190045798 X:47110947-47110969 GGATCCCGCACCTGGGCTGCAGG + Intergenic
1190413896 X:50163275-50163297 GGATCCTGCACCGGGGCTGCAGG + Intergenic
1191249960 X:58255548-58255570 GGGCCCAGCACAGGGGCTGCTGG + Intergenic
1191251533 X:58262339-58262361 GGGCCCAGCACAGGGGCTGTTGG - Intergenic
1191251628 X:58262726-58262748 GGGCCCGGCGCAGGGGCTGCTGG - Intergenic
1191251916 X:58263892-58263914 GGGCCCAGCACAGGGGCTGCTGG - Intergenic
1191251973 X:58264116-58264138 GGGCCCGGCGCAGGGGCTGCTGG - Intergenic
1191252399 X:58265822-58265844 GGGCCCTGCGCAGGGGCTGCTGG + Intergenic
1191252443 X:58266016-58266038 GGGCCCTGCACAGTGGCTGCTGG + Intergenic
1191252558 X:58266486-58266508 GGGTCCCATGCAGGGGCTGCCGG + Intergenic
1191252782 X:58267359-58267381 TGGCCCAGCACAGGGGCTGCCGG + Intergenic
1191253492 X:58270141-58270163 AGGCCCCGCACAGAGGCTGCCGG + Intergenic
1191255193 X:58276639-58276661 GGGTCAGGCACAAGGGCTGCCGG + Intergenic
1191255534 X:58278020-58278042 GGGTCAGGCGCAGGGGCTGCCGG + Intergenic
1191257658 X:58286591-58286613 GGGTCATGCGCAGGGGCTGCCGG + Intergenic
1191258054 X:58288370-58288392 GGGACTGGCACAGGGGCTGCCGG - Intergenic
1192181134 X:68916475-68916497 GGACCCAGTGCAGGGGCTGCAGG + Intergenic
1192186823 X:68952531-68952553 GGATCCCGCACTGGGGCTGCAGG - Intergenic
1192251480 X:69417179-69417201 GGATCCCGCACTGGGGCCACAGG - Intergenic
1192869595 X:75173541-75173563 GGATCCTACACCGGGGCTGCAGG + Intergenic
1192870502 X:75179460-75179482 GGATCCTACACCAGGGCTGCAGG + Intergenic
1193040139 X:76996602-76996624 GGATCCCGCACTGGGGCTGCAGG + Intergenic
1193271136 X:79530999-79531021 GGATCTCGCACTGGGGCCGCAGG - Intergenic
1193538089 X:82738147-82738169 GGATCCCGCACCGGGGCTGCAGG + Intergenic
1193803968 X:85972302-85972324 GGATCCCGCACCAGGGCTGCAGG + Intronic
1194071533 X:89330973-89330995 GGATCCCACACTGGGGCTGCAGG + Intergenic
1194121143 X:89965590-89965612 GGATCTCGCACCGGGGCTGCAGG + Intergenic
1194166414 X:90521752-90521774 GGATCCCGCACTGGGGCTGCAGG - Intergenic
1194204544 X:90995819-90995841 GGATCCCACACAGGGGCCGTGGG - Intergenic
1194340374 X:92699429-92699451 GGATCCCGCACCAGGGCCACGGG + Intergenic
1194650751 X:96512195-96512217 GGATCCCGCACCGGGGCTGCAGG + Intergenic
1195257967 X:103107292-103107314 GGATCCCACACTGGGGCTGCAGG + Intergenic
1195896297 X:109749278-109749300 GGATCCCTCACTGGGGCTGCAGG + Intergenic
1195909536 X:109875838-109875860 GGATCCCGCACAGGAGCCGCTGG + Intergenic
1196197857 X:112854843-112854865 GGATCCCGCACAGGGGCTGCAGG + Intergenic
1196319464 X:114270504-114270526 GGATCCGGCACCGGGGCTGCAGG + Intergenic
1196662461 X:118282685-118282707 GGATCCCGCACAGGGGCTGCAGG + Intergenic
1196705839 X:118716880-118716902 GGATCCCGCACTGGGGCTGCAGG + Intergenic
1196714681 X:118799373-118799395 GGATCCCGCACAGGGGCTGCAGG - Intergenic
1196728864 X:118921927-118921949 GGATCCCGCACCGGGACTGCAGG + Intergenic
1196741582 X:119029932-119029954 GGATCCTACACCGGGGCTGCAGG - Intergenic
1196762278 X:119210823-119210845 GGAACCCGCACCAGGGCTGCAGG + Intergenic
1196771570 X:119300098-119300120 GGATCCCGCACCAGGGCTGCAGG - Intergenic
1196775272 X:119332291-119332313 GGATCCCGCACCAGGGCTGCAGG - Intergenic
1196775576 X:119334012-119334034 GGATTCTGCACCGGGACTGCAGG - Intergenic
1196781398 X:119387528-119387550 GGATCCCGCACTGGGCCTGCAGG + Intergenic
1196793914 X:119487807-119487829 GGATCCCACACTGGGGCTGCAGG + Intergenic
1196827200 X:119750765-119750787 GGATCCCGCACTGGGGCCGCAGG + Intergenic
1196845124 X:119891007-119891029 GGATCCCACACCAGGGCTGCAGG - Intergenic
1196860789 X:120025712-120025734 GGATCCCGCACCTGGGCGGCAGG + Intergenic
1197331107 X:125155412-125155434 GGATCTCGTACTGGGGCTGCAGG + Intergenic
1197340116 X:125256051-125256073 GGATCTCGCACTGGGGCTGCAGG - Intergenic
1197344762 X:125319006-125319028 GGATCCCGCACCAGGGCTGCAGG + Intergenic
1197376730 X:125690522-125690544 GGATTTCGCACTGGGGCTGCTGG + Intergenic
1197533713 X:127662957-127662979 GGATCCCGCACAGGGGCCACAGG + Intergenic
1197977515 X:132181485-132181507 GGATCCCTTCCAGGAGCTGCAGG + Intergenic
1197978824 X:132194502-132194524 GGATCCCCCACAGGGGCCGCAGG - Intergenic
1198060984 X:133044796-133044818 GGATCCCACACTGGGGCTGCAGG - Intronic
1198256208 X:134926045-134926067 GGATCCTGCACAGGGGCCACAGG - Intergenic
1198300055 X:135325871-135325893 GGATCCTGCACCGGGGCTGCAGG - Intronic
1198468173 X:136921780-136921802 GGATCCTGCACCGGGGCCGCAGG - Intergenic
1198664246 X:139003969-139003991 GGATCCTGCACCGGGGCTGCAGG + Intronic
1198694525 X:139321220-139321242 GGATCCCCCACCGGGGCCGCAGG - Intergenic
1198872248 X:141188482-141188504 GGGTCTCGCACTGGGGCTGCAGG + Intergenic
1198972520 X:142298189-142298211 GGATCCCGCACAGGGGCTGCAGG + Intergenic
1199009870 X:142745667-142745689 GGATCCCGCAGCGGGGTGGCAGG + Intergenic
1199028734 X:142972080-142972102 GGATCCTGCACCGGGACTGCAGG + Intergenic
1199050165 X:143228635-143228657 GGATCCCGCACAGGGGCTGCAGG + Intergenic
1199134103 X:144231195-144231217 GGATCCCGCACCGAGGCTGCAGG + Intergenic
1199175609 X:144784035-144784057 GGATCCCGCACCGGGGCTGCAGG - Intergenic
1199356175 X:146866826-146866848 GGATCCCGCACAGGGGCTGCAGG + Intergenic
1199831211 X:151551130-151551152 GGATCCTGCACCGGGGCTGCAGG + Intergenic
1199831728 X:151555135-151555157 GGATCCTGCACCGGGGCTGCAGG + Intergenic
1200078974 X:153566223-153566245 GGATCCTGGACAGGGCCTGGAGG - Intronic
1200223149 X:154401974-154401996 GTGTCCCGGAAAGGGGCTGCAGG - Exonic
1200423494 Y:2998319-2998341 GGATCCCGCACCGGGGCTGCAGG + Intergenic
1200470825 Y:3584034-3584056 GGATCCCACACCAGGGCTGCAGG + Intergenic
1200473997 Y:3623041-3623063 GGATCTCGCACCGGGGCTGCAGG + Intergenic
1200512683 Y:4099533-4099555 GGATCCCGCACCGGGGCTGCAGG - Intergenic
1200648743 Y:5816181-5816203 GGATCCCGCACCAGGGCCGCGGG + Intergenic
1200725771 Y:6666702-6666724 GGATCCCACACTGGGGCTGCAGG + Intergenic
1200787488 Y:7273516-7273538 GGATCCCCAAGAGGGGCTGCCGG - Intergenic
1200824225 Y:7622160-7622182 GGATCCCACACCGGGGCTGCAGG + Intergenic
1200888739 Y:8299033-8299055 GGATCCCGCACCGGGGCTGCAGG - Intergenic
1201285411 Y:12374953-12374975 GGATCTTGCACAGGGGCTGCAGG + Intergenic
1201422980 Y:13820149-13820171 GGATCTCGCACAGGGGCTGCAGG + Intergenic
1201468402 Y:14309660-14309682 GGATCCCACACTGGGGCCGCAGG - Intergenic
1201469166 Y:14314867-14314889 GGATCCCGCACTGGGGCTGCAGG - Intergenic
1201480004 Y:14428507-14428529 GGATCCCGCACCGGGGCTGCAGG - Intergenic
1201487135 Y:14506067-14506089 TGATCCAGCACCAGGGCTGCAGG - Intergenic
1201488225 Y:14513230-14513252 TGATCCAGCACCGGGGCTGCAGG - Intergenic
1201495627 Y:14589727-14589749 GGATCCCACACCGAGGCTGCAGG + Intronic
1201715877 Y:17043530-17043552 GGATCCCTCACCGGGGCTGCAGG - Intergenic
1201764201 Y:17564020-17564042 GGGTTCAGCGCAGGGGCTGCTGG + Intergenic
1201764673 Y:17566095-17566117 GGTTCTGGCACAGAGGCTGCTGG + Intergenic
1201764762 Y:17566490-17566512 GGTTCCGGCGCAGAGGCTGCTGG + Intergenic
1201836791 Y:18339500-18339522 GGTTCCGGCGCAGAGGCTGCTGG - Intergenic
1201836880 Y:18339895-18339917 GGTTCTGGCACAGAGGCTGCTGG - Intergenic
1201837352 Y:18341970-18341992 GGGTTCAGCGCAGGGGCTGCTGG - Intergenic
1201901042 Y:19046508-19046530 GGATCTGGCACTGGGGCCGCAGG + Intergenic
1201982553 Y:19923661-19923683 GGATCCCGCACCAGGGCTGCAGG + Intergenic
1202109907 Y:21407618-21407640 GGATCGCGCACTGGGGCTGCAGG - Intergenic
1202137022 Y:21676607-21676629 GGATCCCGCACCGGGGCTGCAGG + Intergenic
1202235829 Y:22708927-22708949 GGATCCCACACCGGGGCTGCAGG - Intergenic
1202307334 Y:23487241-23487263 GGATCCCACACCGGGGCTGCAGG + Intergenic
1202563471 Y:26183345-26183367 GGATCCCACACCGGGGCTGCAGG - Intergenic