ID: 985403795

View in Genome Browser
Species Human (GRCh38)
Location 4:189616592-189616614
Sequence TCCCGCACAGGGGCTGCAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1804
Summary {0: 35, 1: 325, 2: 499, 3: 420, 4: 525}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985403785_985403795 13 Left 985403785 4:189616556-189616578 CCAGACTCAGGAGCCCAGCTGGC 0: 1016
1: 565
2: 314
3: 310
4: 533
Right 985403795 4:189616592-189616614 TCCCGCACAGGGGCTGCAGGTGG 0: 35
1: 325
2: 499
3: 420
4: 525
985403788_985403795 -1 Left 985403788 4:189616570-189616592 CCAGCTGGCTTCACCCAGTGGAT 0: 862
1: 802
2: 346
3: 181
4: 237
Right 985403795 4:189616592-189616614 TCCCGCACAGGGGCTGCAGGTGG 0: 35
1: 325
2: 499
3: 420
4: 525
985403787_985403795 0 Left 985403787 4:189616569-189616591 CCCAGCTGGCTTCACCCAGTGGA 0: 849
1: 786
2: 340
3: 179
4: 241
Right 985403795 4:189616592-189616614 TCCCGCACAGGGGCTGCAGGTGG 0: 35
1: 325
2: 499
3: 420
4: 525
985403781_985403795 18 Left 985403781 4:189616551-189616573 CCCCACCAGACTCAGGAGCCCAG 0: 905
1: 703
2: 377
3: 429
4: 653
Right 985403795 4:189616592-189616614 TCCCGCACAGGGGCTGCAGGTGG 0: 35
1: 325
2: 499
3: 420
4: 525
985403780_985403795 24 Left 985403780 4:189616545-189616567 CCAGGTCCCCACCAGACTCAGGA 0: 14
1: 737
2: 800
3: 512
4: 1029
Right 985403795 4:189616592-189616614 TCCCGCACAGGGGCTGCAGGTGG 0: 35
1: 325
2: 499
3: 420
4: 525
985403783_985403795 16 Left 985403783 4:189616553-189616575 CCACCAGACTCAGGAGCCCAGCT 0: 903
1: 749
2: 401
3: 335
4: 763
Right 985403795 4:189616592-189616614 TCCCGCACAGGGGCTGCAGGTGG 0: 35
1: 325
2: 499
3: 420
4: 525
985403782_985403795 17 Left 985403782 4:189616552-189616574 CCCACCAGACTCAGGAGCCCAGC 0: 889
1: 747
2: 391
3: 420
4: 588
Right 985403795 4:189616592-189616614 TCCCGCACAGGGGCTGCAGGTGG 0: 35
1: 325
2: 499
3: 420
4: 525

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985403795 Original CRISPR TCCCGCACAGGGGCTGCAGG TGG Intergenic
900113198 1:1018259-1018281 TCCCGCACTGGGGCTGCAAGTGG + Intergenic
900144119 1:1150589-1150611 ACCCTCACAGGGGCTGCAGGGGG + Intergenic
900145898 1:1158536-1158558 CCCCGCACAGTGGCTGCACTTGG - Intergenic
900458226 1:2787533-2787555 GCCAGCACAGGGGCTGCCTGGGG + Exonic
900580420 1:3405892-3405914 CACCTCACAGGGGCTGGAGGGGG + Intronic
900764424 1:4494511-4494533 CCCCATCCAGGGGCTGCAGGGGG - Intergenic
901045911 1:6395721-6395743 TCCCGCACTGGGGCTGCAGGTGG + Intergenic
901783416 1:11609129-11609151 TCCCACACCGGGGCTGCAGGTGG - Intergenic
902032545 1:13433794-13433816 TCCCACACCGGGGCCGCAGGTGG + Intergenic
902033518 1:13439660-13439682 TCCCCTACCGGGGCCGCAGGTGG - Intergenic
902100355 1:13983110-13983132 TCTCGCACGGGGGCTGCAGGTGG + Intergenic
903027790 1:20441992-20442014 ACCTGCCCAGGGCCTGCAGGAGG + Intergenic
903351200 1:22717469-22717491 CACCCCACAGGGGCTGCAGCAGG - Intronic
903370226 1:22830499-22830521 TCCCTCACAGGGCCACCAGGAGG + Intronic
905185971 1:36197076-36197098 TCCCGCGCCAGGGCTGCAGGTGG - Intergenic
905375704 1:37518665-37518687 TCCCGCACCGGGGCTGCAGGTGG - Intergenic
905581672 1:39087105-39087127 TCCTTCACAGGAGGTGCAGGGGG + Intronic
905742969 1:40388265-40388287 TCTCGCACTGGGGCTGCAGGTGG - Intronic
906083063 1:43107310-43107332 TCTCGCACCAGGGCCGCAGGTGG + Intergenic
906563435 1:46778456-46778478 TTCTGCACCGGGGTTGCAGGGGG + Intronic
906786413 1:48619844-48619866 TCTCTCACAGAGGCTGGAGGCGG - Intronic
906876214 1:49541732-49541754 TCCTGCACAGGGGCCACAGGTGG - Intronic
906877638 1:49556655-49556677 TCCCGCGCAGGGGCCGCAGGCGG + Intronic
906914663 1:49995470-49995492 TACCCCACAGGGGCTGAAGCAGG + Intronic
907102161 1:51847325-51847347 TCCAGCACCGGGCCAGCAGGTGG + Intronic
907408780 1:54270360-54270382 CACCGCACAGGAGCTGCCGGGGG - Intronic
907980126 1:59472498-59472520 TCCCGCACCGGGGCTGCAGGTGG - Intronic
908027678 1:59969611-59969633 ATCCGCACCGGGGCTGCAGGTGG + Intergenic
908291415 1:62670303-62670325 TCCCGCACCAGGGCTGCAGGTGG - Intronic
908400359 1:63767052-63767074 TCCCACCCTGTGGCTGCAGGTGG - Intergenic
908888660 1:68818121-68818143 TCTCGCACTGGGGCTGCAGGTGG - Intergenic
909317953 1:74247847-74247869 TCCCACGCAGGGGCCGCAGGCGG + Intronic
909318471 1:74253284-74253306 TCCCGCACAGGGGCCGCAGGTGG + Intronic
909377003 1:74951995-74952017 TCCTGCACCAGGGCTGCAGGTGG + Intergenic
909443670 1:75724679-75724701 TCCCGCCCACGGGCTCCAGTGGG + Intronic
909759311 1:79269533-79269555 TCCTGCACCGGGGCTGCAGGTGG - Intergenic
909904492 1:81178554-81178576 TCCGGCACCGGGGCTGCAGGTGG + Intergenic
910034694 1:82776729-82776751 TCCCGCACCAGGGCTGCAGGTGG + Intergenic
910237124 1:85048041-85048063 TCCAGCCCAGGGGCTCCGGGCGG + Intronic
910478755 1:87636176-87636198 TCCCGCACCAGGGCCACAGGTGG + Intergenic
910609680 1:89127988-89128010 TCCCGCACAGGGGCTGCAGGTGG + Intronic
911001519 1:93170642-93170664 TCCCGCACCTGGGCCGCAGGTGG - Intronic
911205989 1:95091780-95091802 TCCTGCACCGAGGCTGCAGGTGG - Intergenic
911259523 1:95669575-95669597 TCCCACACCGGTGCTGCAGGTGG + Intergenic
911305159 1:96224285-96224307 TCCCACGCTGGGGCTGCAGGTGG + Intergenic
911954426 1:104217391-104217413 TCCCGCACTGGGGCTGCAGGTGG + Intergenic
912058050 1:105631182-105631204 TCCCGCACCAAGGCTGCAAGTGG + Intergenic
912166233 1:107045181-107045203 TCCCACACCTGGGCTGCAGGTGG - Intergenic
912312802 1:108640816-108640838 TCCCGCACCGGGGCTGCAGGTGG + Intronic
912316001 1:108667889-108667911 TCCTGCACCAGAGCTGCAGGTGG - Intergenic
912538681 1:110396278-110396300 TCTCGCACTGGGGCCGCAGGTGG + Intergenic
913160993 1:116146501-116146523 TCCCGCACTGGGGCTGCAGGTGG + Intergenic
913279801 1:117174897-117174919 TGCTGCACTGGGGGTGCAGGGGG + Intronic
913469073 1:119171918-119171940 TCCCGCACCGGGGCCGCAGGTGG - Intergenic
913470256 1:119179437-119179459 TCCTGCACCAGGGCCGCAGGTGG - Intergenic
913692041 1:121289051-121289073 TCCCGCACCGGGGCTGCAGGTGG + Intronic
913987167 1:143575468-143575490 TCTCGCACCAGGGCCGCAGGTGG - Intergenic
914095360 1:144540124-144540146 TCCCGCACGGGGGCTCCACCAGG + Intergenic
914145517 1:144991063-144991085 TCCCGCACCGGGGCTGCAGGTGG - Intronic
914201257 1:145487444-145487466 TCCCGCACGGGGGCTCCACCAGG + Intergenic
914303166 1:146393772-146393794 TCCCGCACGGGGGCTCCACCAGG - Intergenic
914438362 1:147680713-147680735 TCCCGCACCAGGGCTGCAGGTGG + Intergenic
914480374 1:148060576-148060598 TCCCGCACGGGGGCTCCACCAGG + Intergenic
914490918 1:148149630-148149652 CCCCACCCAGGGGCTGCATGTGG + Intronic
914516560 1:148379401-148379423 TCCCGCACGGGGGCTCCACCAGG + Intergenic
914928131 1:151906550-151906572 TCTCGCACTGGGGCTGCAGGTGG - Intronic
915104196 1:153522190-153522212 TCCTGCACCAGGGCTGCAGGTGG - Intergenic
915242255 1:154532036-154532058 TCTCGCACCGGGGCCACAGGTGG + Intronic
915260138 1:154671175-154671197 TCCCACATCAGGGCTGCAGGTGG - Intergenic
915261308 1:154678462-154678484 TCCCACATCAGGGCTGCAGGTGG - Intergenic
915603994 1:156939568-156939590 TCAAGCACAGAGGCAGCAGGAGG - Exonic
915666032 1:157446230-157446252 TCTCCCACGGGGGCTACAGGTGG + Intergenic
915764414 1:158348936-158348958 TCCTGCACTGGGGCTGCAGATGG + Intergenic
915865475 1:159494555-159494577 TCCCGCACCAGGGCTGCAGATGG + Intergenic
916219940 1:162433565-162433587 TCCTGCACTGGGGCTGCAGGTGG - Intergenic
916277865 1:163014282-163014304 TCCCCCTCAGCGGCTGCAGCAGG - Intergenic
916605877 1:166342807-166342829 TCCTGCACCAGGGCCGCAGGTGG + Intergenic
916910037 1:169337021-169337043 TCCCGCACCGGGGCTGCAGGTGG + Intronic
916939099 1:169661586-169661608 TCCCACACCAGGGCTGCAGGTGG - Intergenic
916940137 1:169668424-169668446 TCCCACGCCGGGGCTGCTGGTGG - Intronic
916960358 1:169882524-169882546 TCCCGCACTGGGGCTGCAGGTGG - Intronic
916991541 1:170250668-170250690 TCCCACGCAGGGGCCCCAGGCGG + Intergenic
917348794 1:174056356-174056378 TCCCGCACTGGGGCTGTAGGTGG + Intergenic
917445339 1:175102247-175102269 TCCCGCACTGGGGCTGCAGGTGG + Intronic
917446294 1:175108404-175108426 TCCCGCACTGGGGCTGCAGGTGG + Intronic
917932912 1:179836844-179836866 GCCCCCACCGGGGCCGCAGGTGG + Intergenic
918059085 1:181046242-181046264 TCCCCCACTGGGGCTGCAGGTGG - Intronic
918154648 1:181832824-181832846 TCCTGCACCAGGGCCGCAGGCGG - Intergenic
918659690 1:187073763-187073785 TCCCGCACGGGGGCTGCAGGTGG + Intergenic
918709017 1:187704033-187704055 TCCCGCACCGGGGCTGCAGGTGG - Intergenic
918720907 1:187850615-187850637 TCCCGCACAGGGGCTGCAGGTGG - Intergenic
918791966 1:188841122-188841144 TCCTGCACTGAGGCTGCAGGTGG + Intergenic
918853138 1:189718246-189718268 TCCCGCACGAGGGCTGCCGGTGG + Intergenic
918942913 1:191025947-191025969 TCCCGCACCAGGGCCACAGGCGG + Intergenic
918952068 1:191151795-191151817 TCCCGCACCGGGGCTGCAGGTGG - Intergenic
919091979 1:192987322-192987344 TCCCACACCAGGGCTGCGGGTGG - Intergenic
919167880 1:193918859-193918881 TCCCGCACCAGCGCTGCAGGTGG + Intergenic
919174544 1:194002252-194002274 TCCCGCACCAGGGCTGCAGGTGG - Intergenic
919201278 1:194358216-194358238 TGCCACACCAGGGCTGCAGGTGG + Intergenic
919223817 1:194667108-194667130 CGCCGCCCATGGGCTGCAGGTGG + Intergenic
919237091 1:194859413-194859435 TCCCGCACCGGTGCTGCAGGTGG - Intergenic
919250903 1:195054691-195054713 TCCCTTACTGGGGCTGCAGGTGG - Intergenic
919297703 1:195722861-195722883 TCCAGCACGGGGGCTGCAGGTGG + Intergenic
919397366 1:197068357-197068379 TGTCTCACAGGGGCTGCCGGAGG + Intergenic
919419698 1:197355342-197355364 TCCCACGCAGGGGCCGCAGGTGG + Intronic
919631018 1:199960033-199960055 TCCCGCACTGGGGCCGCAGGTGG - Intergenic
919925035 1:202187762-202187784 TCCCGGGCTGGGGCTGCTGGGGG + Intergenic
920479362 1:206307399-206307421 TCCCGCACCGGGGCTGCAGGTGG + Intronic
920561972 1:206945375-206945397 TCCGGCACAAGGGCAGCAGCGGG - Intronic
920731297 1:208488385-208488407 TCCCACACTGGGGCTGCAGGTGG + Intergenic
920756758 1:208740091-208740113 TCCCGCACCGGGGCTGCTGGTGG - Intergenic
920878384 1:209858596-209858618 TACCGCAGCGGGGCCGCAGGTGG + Intergenic
920881952 1:209888895-209888917 TCCCGCACCCGGGCTGCAGGTGG + Intergenic
920883078 1:209898748-209898770 TCCCGCACCGGGGCTGCAGGTGG + Intergenic
921094331 1:211874211-211874233 TCCCGCACAGGGGCCACAGGTGG + Intergenic
921396304 1:214673094-214673116 TCCCGCACCCGGGCTGCAGGTGG + Intergenic
921801882 1:219411065-219411087 TCCGGCACCGGGGCTGCAGGTGG - Intergenic
921897167 1:220412845-220412867 TCCCGCACCGGGGCTGCAGGTGG - Intergenic
921903759 1:220475615-220475637 TCCAGCACGGGGGCTGCAGGTGG + Intergenic
921983599 1:221285605-221285627 TCCCGCACCAGGACTGCAGTTGG + Intergenic
922056899 1:222050159-222050181 TCCCGCACAGGGGCTGCAGGTGG - Intergenic
922291372 1:224211523-224211545 ACCAGCACAGGAGCTGCAGAAGG - Intergenic
922306905 1:224352466-224352488 TTCACCACGGGGGCTGCAGGTGG + Intergenic
922423286 1:225473120-225473142 TCCCGCACCGGGGCTGCAGGTGG - Intergenic
922485500 1:225970179-225970201 TCCCGCACTGGTGCTGCAGATGG - Intergenic
922541835 1:226426241-226426263 TCACGCACCAGGGCTGCAGGTGG + Intergenic
922855867 1:228774117-228774139 TCCCGCACCGGGGCTGCAGGTGG - Intergenic
922985951 1:229865869-229865891 TCCCGCACCAGGGCTGCGGGTGG - Intergenic
923172532 1:231430766-231430788 TCCCGCACTGGGGCCGCAGGTGG + Intergenic
923193383 1:231641896-231641918 TCCCGCACCGGGGCTACAGGTGG + Intronic
923324739 1:232871391-232871413 TCCCGCACCGGGGCTGCAGGTGG + Intergenic
923353258 1:233129533-233129555 TCCCACACTGAGGCCGCAGGTGG - Intronic
923573893 1:235140707-235140729 TCCTGCACCGGGGCTGCAGGTGG - Intronic
923681153 1:236119757-236119779 TCCAGCACTGGGACTGCAGACGG - Intergenic
923689527 1:236178763-236178785 TCCCACACAGGGGCTACTCGAGG + Intronic
923810447 1:237309577-237309599 TCCCACACAAGGGCCGCAGGCGG + Intronic
923930005 1:238684579-238684601 TCCCCCACAGGGGCTGCAGGTGG + Intergenic
924117598 1:240762901-240762923 TCCCGCACCGGGGCTGCAGGTGG - Intergenic
924205848 1:241710726-241710748 TCCAGCACAGGGGCAAGAGGAGG + Intronic
924560339 1:245153578-245153600 TCCCGCGCAGGAGCTGGAGCGGG + Intergenic
1063071529 10:2671446-2671468 TCCTCCACAGGGGGTCCAGGGGG - Intergenic
1063148872 10:3319761-3319783 TCCCACACCTGGGCTGCAGGTGG + Intergenic
1063309241 10:4937374-4937396 TCCCGCACCAGGGCCGCAGGTGG + Intronic
1063318649 10:5032466-5032488 TCCCGCACCGGGGCTGCAGGTGG + Intronic
1063322123 10:5060634-5060656 TCCCACACTGGGGCTGCAGGTGG + Intronic
1063769773 10:9183763-9183785 TCCCGCACCAGGGCTGCAGGTGG - Intergenic
1063960333 10:11301325-11301347 GCCCGCATAGGGGCTCCAGTGGG - Intronic
1064032792 10:11893872-11893894 TCCCGCATTGGGTCTGCTGGTGG - Intergenic
1064197862 10:13260019-13260041 TCCGGCACTGGGGCTGCAGGTGG - Intergenic
1064461103 10:15535350-15535372 TCCCGCACCGGCGCCGCAGGTGG - Intronic
1064790286 10:18951226-18951248 TCCCACACCAGGGCTGCAGGTGG + Intergenic
1064985267 10:21203843-21203865 GCCTGCACACGGGCTGCAAGGGG - Intergenic
1065441412 10:25756411-25756433 TCCCGTACCGGGGCTGCAGGTGG - Intergenic
1065554979 10:26905957-26905979 TCCTGCACAGGGGCTGCAGGTGG - Intergenic
1065743205 10:28815621-28815643 TCCCGCACAGGGGCTGCAGGTGG + Intergenic
1065752101 10:28896767-28896789 TCCCGCACCGGAGCTGCAGATGG + Intergenic
1065802680 10:29366592-29366614 TCCCACACCAGGGCTGCAGGTGG - Intergenic
1065895958 10:30163225-30163247 TCCCGCACAGGGGCTGCAGGTGG - Intergenic
1065995583 10:31056233-31056255 TCCTGCACCAGGGCCGCAGGTGG - Intergenic
1066190342 10:33049639-33049661 TCCCGCACCGGGGCTGCAGGTGG - Intergenic
1066234121 10:33468446-33468468 TCCCACACCGGGGCTGTAGGTGG - Intergenic
1066235381 10:33480415-33480437 TCCCACACCGGGGCTGCAGGTGG + Intergenic
1066296170 10:34055928-34055950 TCCCGCACGGGGGCTGCAGGTGG - Intergenic
1066544170 10:36481945-36481967 TCCTGCACCGGGCCTGCAGTTGG + Intergenic
1066567325 10:36734566-36734588 TCCCGCACTGGGGCTGCAGGTGG + Intergenic
1066598269 10:37076376-37076398 TCCTGCACTGGGGCCTCAGGTGG - Intergenic
1066614993 10:37285115-37285137 TCCCACACCAGGGCTGCGGGCGG + Intronic
1066660952 10:37737742-37737764 TCCCGCACGGGGGCCACAGGTGG - Intergenic
1067363269 10:45601154-45601176 TCCCACACCAGGGCTGCAGGTGG - Intergenic
1067473244 10:46550667-46550689 TCTGGGACAGGGGCTGAAGGCGG + Exonic
1068211402 10:53924592-53924614 TCCTGCACTGGGGCCGCAGGCGG - Intronic
1068374098 10:56155537-56155559 TCCCGCACCAGGGCTGCAGGTGG - Intergenic
1068455604 10:57250253-57250275 TGCCGCCCTGGGGCTGCAGGTGG - Intergenic
1068460435 10:57321889-57321911 TCCCGCCCAGGGGCTGCAGGTGG - Intergenic
1068792346 10:61041027-61041049 TCCCGCACCAGGGCTGCAGGTGG - Intergenic
1068902191 10:62280791-62280813 TCCCACACCAGGGCTGCAGGTGG - Intergenic
1068978215 10:63034002-63034024 TCCCGCACCGGGGCTGCAGGTGG - Intergenic
1069186446 10:65429355-65429377 TCCCGCACAGGGGCTGCAGGTGG + Intergenic
1069660973 10:70123343-70123365 TCCCGCCCAGGCCCTGCAGAGGG + Intronic
1069709264 10:70478634-70478656 TCCCGCCCGGGGGCTGCGGCTGG + Intergenic
1069723973 10:70565893-70565915 TCCCCCACTGGGGCTGGGGGAGG + Intronic
1069766220 10:70862074-70862096 TCCCGCACCGGGGCTGCGGGTGG - Intronic
1069993050 10:72326367-72326389 TCGTGCACCGGGGCTGCAGGTGG - Intergenic
1070242190 10:74693574-74693596 TCCCTCACAGGGAATGCCGGGGG - Intronic
1070564018 10:77590228-77590250 TCCCGCACCGGGGCCGCAGGTGG + Intronic
1070937957 10:80315814-80315836 TCCCGCACTGGGGCCACAGGTGG - Intergenic
1070941987 10:80356520-80356542 CCCCGCTCAGGGGGAGCAGGAGG + Intronic
1070942493 10:80359444-80359466 TCCCGCATCAGGGCTGCAGGCGG + Intronic
1070968380 10:80543627-80543649 TCCCGCACTGGGGCTGCAGGTGG - Intronic
1070973454 10:80586287-80586309 TCGCGCACCAGGGCCGCAGGTGG - Intronic
1071003833 10:80859667-80859689 TCCCGCACCGGGGCTGCAGGTGG - Intergenic
1071037405 10:81264861-81264883 TCCTACACCAGGGCTGCAGGTGG + Intergenic
1071041013 10:81309022-81309044 TCCCGCACCGGGACTGCAGGTGG + Intergenic
1071055760 10:81506186-81506208 TCCTGCACCAGGGCTGCAGGTGG - Intergenic
1071078786 10:81784631-81784653 TCCTGCACTGGGGCAGCAGGTGG - Intergenic
1071085281 10:81862632-81862654 TCCTGCACTGGGGCCACAGGTGG + Intergenic
1071388076 10:85141813-85141835 TCCCGCACAAGGGCTGCAGGTGG - Intergenic
1071797013 10:89018601-89018623 TCCTGCACCGGGGCTGCAGGTGG + Intergenic
1071900934 10:90119777-90119799 TCCCACACCGGGGCTGCAGGTGG + Intergenic
1071963711 10:90832122-90832144 TCTGGCACTGGGGCTGCAGGTGG + Intronic
1072278558 10:93845566-93845588 TCCCACACTGGGGCTGCAGGTGG - Intergenic
1072440305 10:95448354-95448376 GCCAGCACAGTGGCTGGAGGGGG - Intronic
1073789697 10:106928052-106928074 TCCCGCACCGGCGCTGCATGTGG + Intronic
1074098210 10:110331879-110331901 TCCCGCACTGGGGCCGCAGGTGG - Intergenic
1074174980 10:110990176-110990198 TCCCGCACCAGGGCTGCAGGTGG - Intronic
1074317359 10:112371629-112371651 TCCCGCACCGTGGCCACAGGTGG - Intergenic
1074732536 10:116393765-116393787 TCTTGCACCGGGGCCGCAGGTGG - Intergenic
1074910290 10:117902468-117902490 TCCCCCACAGAGGTTCCAGGGGG - Intergenic
1074996271 10:118760094-118760116 TCCAGCAAGAGGGCTGCAGGTGG + Intergenic
1074999305 10:118783316-118783338 TCCCGCACCGGGGCTGCAGGTGG - Intergenic
1075255699 10:120924238-120924260 TCCCGCAAAGGGGCTGCAGGTGG - Intergenic
1075280879 10:121137244-121137266 TCCTGCAGAAGGCCTGCAGGAGG + Intergenic
1075305782 10:121365943-121365965 TCCCGCACTGGGGCTGCAGGTGG - Intergenic
1075307692 10:121382532-121382554 TCCCGCACTGGGGCTGCAGGTGG - Intergenic
1075537445 10:123283301-123283323 TCCCGCAAAGGGGCTGCAGGTGG + Intergenic
1076261580 10:129071299-129071321 TCCCGCACCGGGGCTGCAGGTGG + Intergenic
1076608017 10:131701883-131701905 GTCTGCACAGGGGCTGCAGGTGG - Intergenic
1076691344 10:132225203-132225225 CCAAGCCCAGGGGCTGCAGGGGG + Intronic
1076773688 10:132681067-132681089 TCCCGCACTGGGGCTGCAGGTGG - Intronic
1076796460 10:132800892-132800914 TCCCGCACTGGGGCTGCAGGTGG + Intergenic
1077442303 11:2574449-2574471 GGCCGCACGGGGGCTGGAGGTGG + Intronic
1077499933 11:2904736-2904758 ACACGCACAGGGGCTGCAGTGGG + Intronic
1077556322 11:3227820-3227842 TGCCTCACGGGGGCTGCAGCTGG + Exonic
1077603303 11:3589093-3589115 TCCCGCACAAGAGCTGCAGGTGG - Intergenic
1077764669 11:5144809-5144831 TCCCACACCGGGGCTGCAGGTGG - Intergenic
1077778144 11:5294390-5294412 TCCCGCACCTGGGCTGCAGGGGG + Intronic
1077805840 11:5590292-5590314 TCCCACACAGGGGCTGCAGGTGG - Intronic
1078251827 11:9622982-9623004 TCCCGCACCGGGGCTGCAGGTGG + Intergenic
1078301125 11:10133251-10133273 TCCCGCGTAGGGGCTGCAGGTGG + Intronic
1078743617 11:14091274-14091296 TCCCGCACCGGGGCTGCAGGTGG + Intronic
1078795897 11:14591478-14591500 TCCCACACTGGGGCTGCAGGTGG - Intronic
1078891417 11:15561336-15561358 TACCGCACCGGGGCCGCAGGTGG - Intergenic
1079190910 11:18276083-18276105 TCCCGCACCGGGGCCACAGGTGG + Intergenic
1079555350 11:21753089-21753111 TCCCGCACGGGGGCTGCAGGTGG + Intergenic
1079726147 11:23883378-23883400 TCCCGCACCAGGGCTGCAGGTGG + Intergenic
1079767696 11:24415948-24415970 TCCCACACTGGGGCTGCAGATGG + Intergenic
1080105953 11:28512280-28512302 TCCCGCACCGGGGCAGCAGGTGG + Intergenic
1080107427 11:28525744-28525766 TCCCGCACCGGGGCCGCAGGTGG + Intergenic
1080138902 11:28891030-28891052 TCCCGCACTGGGGCCGCAGGTGG - Intergenic
1080195127 11:29600095-29600117 TCCTACACCGGGGCTGCAGGTGG + Intergenic
1080547424 11:33334716-33334738 CCCGGCCCAGGGGCTGCATGAGG - Intronic
1080557619 11:33431690-33431712 TCCCGCACCGGGGCTGCAGGTGG + Intergenic
1080621522 11:33990512-33990534 TCCCGCACCGGGGCTGCAGGTGG - Intergenic
1080742495 11:35079392-35079414 TCCCACACATGGCCTGGAGGAGG + Intergenic
1081115278 11:39192579-39192601 TCTTGCACTGGGGCTGCAGGGGG + Intergenic
1081125135 11:39312245-39312267 TCCCGCACCGGGGCTGCAGGTGG - Intergenic
1081126862 11:39333016-39333038 TCCTGCACCGGGGCCGCAGGTGG + Intergenic
1081324398 11:41728038-41728060 TCTTGCACCAGGGCTGCAGGTGG + Intergenic
1081420973 11:42874326-42874348 TCCTGCACCAGGGCTGCAGGTGG - Intergenic
1081422142 11:42881796-42881818 TCCCGCACTGGGGCTGCAGGTGG - Intergenic
1081428460 11:42950299-42950321 TCCCGCACGAGGGCTGCAGGTGG - Intergenic
1081733207 11:45385580-45385602 TCCAGCACAGGGGATGCACAGGG + Intergenic
1082270374 11:50163994-50164016 TCCCGTACTGGGGCTGCAGGTGG + Intergenic
1082272193 11:50183687-50183709 TCCCGCCCTGGGGCTGCAGGTGG - Intergenic
1082698685 11:56401867-56401889 TCCTGCACCGGGGCTGCAGGTGG + Intergenic
1083074224 11:60020204-60020226 TCCCATACCGGGGCTGCAGGTGG + Intergenic
1083448524 11:62727051-62727073 TCTGGCGCAGCGGCTGCAGGAGG - Exonic
1083546184 11:63550617-63550639 TCCTGCACCGGGGCTGCAGGTGG - Intergenic
1083851796 11:65372293-65372315 TCCTGCACAGTGGCCCCAGGAGG - Intergenic
1084024675 11:66440725-66440747 TCCCGCACCCGGGCTACAGGTGG + Intronic
1084107486 11:66989206-66989228 TCCCGCACCGGGGCTGCAGGTGG - Intergenic
1084182947 11:67455673-67455695 GCCGGCCCAGGGGATGCAGGGGG - Exonic
1084186716 11:67476466-67476488 TCGCGCACCGTGGCTGCAGGTGG - Intergenic
1084210541 11:67619450-67619472 TCCTGCACCGGTGCTGCAGATGG - Intergenic
1084240629 11:67817604-67817626 TCCTGCACTGGGGCCACAGGTGG + Intergenic
1084259198 11:67963636-67963658 TTCTGCACAGGAGCTGCAGGTGG - Intergenic
1084426525 11:69087141-69087163 TCCCAGCAAGGGGCTGCAGGTGG - Exonic
1084679890 11:70660820-70660842 TCCCGCACCTGTGCTGCAGGAGG - Intronic
1084764982 11:71302313-71302335 GCTCGCACAGGGGATGCTGGAGG - Intergenic
1084813573 11:71631543-71631565 TCCCGCACAGGAGCTGCAAGTGG + Intergenic
1084831798 11:71775108-71775130 TCCTGCACTGGGGCCGCAGGTGG - Intergenic
1085245678 11:75098621-75098643 TCCCGCACCGGGGCTGCAGGTGG - Intergenic
1085375962 11:76060978-76061000 TCCCGCACCAGGGCCGCAGGTGG - Intronic
1085447180 11:76608976-76608998 TCCTGCACCAGGGCTGCAGGTGG + Intergenic
1085671019 11:78464917-78464939 TCCCACACTGGGGCTGCAGGTGG + Intronic
1086043106 11:82501571-82501593 TCCCGCACCGGGTCTGCAGGTGG - Intergenic
1086210045 11:84308497-84308519 TCCCGCACGGGGGCCACAGGTGG + Intronic
1086397674 11:86433470-86433492 TCCCGCACCGGGGCCGCAGGTGG + Intergenic
1086724702 11:90167555-90167577 TCCCACACCGGGGCCACAGGTGG - Intronic
1086808094 11:91269169-91269191 TCCTGCACCGGGGCTGCAGGTGG - Intergenic
1087354612 11:97077013-97077035 TCCCGCACCAGGGCTGCAGGTGG - Intergenic
1087486313 11:98763355-98763377 TCCCGCACCGGGGCTGCAGGTGG + Intergenic
1087683731 11:101241193-101241215 TCCCGCACCAGGGCCGCAGGTGG + Intergenic
1087868118 11:103258598-103258620 TCCTGCAGAGGTGCTGCAGTTGG - Intronic
1087966492 11:104422377-104422399 TCTCGCACTGGGGCTGCAGGTGG + Intergenic
1088544050 11:110942152-110942174 TCCCACAAAGGGGCAGCATGAGG - Intergenic
1088570950 11:111222390-111222412 TCCCGCACCAGGGCTGCAGGTGG - Intergenic
1089062049 11:115633840-115633862 TCTCGCACTGGGGCTGCAGGTGG + Intergenic
1089191767 11:116659027-116659049 GCCCTCACAGGGGGTGGAGGAGG - Intergenic
1089373495 11:117978434-117978456 TCCCGCACCGGGGCTTCAGGTGG + Intergenic
1089800319 11:121022073-121022095 TCCCGCACCGGGGCTGCAGGTGG - Intergenic
1090229302 11:125089910-125089932 TCCCGCACCGGGGCTGCAGGTGG - Intronic
1090307607 11:125704649-125704671 TCCCGCACCGGGGCTGCAGGTGG + Intergenic
1090776649 11:129971779-129971801 TCCCGCACCGGGGCTGCAGGTGG + Intronic
1091201279 11:133782712-133782734 TCCCAAACCGGGGCCGCAGGTGG - Intergenic
1091233374 11:134002835-134002857 TCCCGCACCGGGGCTGCAGGTGG + Intergenic
1091390932 12:125732-125754 TCAAGCCCAGGAGCTGCAGGAGG + Exonic
1091402175 12:188064-188086 TCCCTCACTGGGGCCACAGGTGG + Intergenic
1092101629 12:5888842-5888864 TCCCACACTGGGGCCGCAGGTGG + Intronic
1092133996 12:6132894-6132916 TCCCGCACTGGGGCCGCAGGTGG - Intergenic
1092137503 12:6159888-6159910 TCCCGCACCTGGGCTGCAGGTGG - Intergenic
1092142032 12:6190818-6190840 TCCCGCACCAGCGCTGCAGGTGG + Intergenic
1092220361 12:6708695-6708717 TCCCACGCTGGGGCTGCAGGTGG - Intergenic
1092221475 12:6716449-6716471 TCCCGCACCGAGACTGCAGGTGG - Intergenic
1092350443 12:7752016-7752038 CACTGCACTGGGGCTGCAGGTGG + Intergenic
1092364126 12:7862599-7862621 TCACGCACCGGTGCTGCAGGTGG - Intronic
1092366625 12:7881689-7881711 TCTTGCACTGGGGCTGGAGGTGG - Intronic
1092410859 12:8252138-8252160 TCCCACATGGGGGCTGCAGGTGG + Intergenic
1092430512 12:8404641-8404663 TCCCGCACAGGAGCCGCAGGTGG - Intergenic
1092471846 12:8787679-8787701 TCCCGCACCGGGGCTGCAGGTGG - Intergenic
1092473041 12:8795138-8795160 TCCCGCACCGGGGCTGCAGGTGG - Intergenic
1092583761 12:9876118-9876140 TCCCGCACCTGGGCTGCAGGTGG + Intergenic
1092617073 12:10225560-10225582 TCCCACACCGGGGCTGCAGGTGG + Intergenic
1092732531 12:11547661-11547683 TCCCCCACCGGGGCTGCAGGTGG - Intergenic
1092834149 12:12472381-12472403 TCCTGCACCAGAGCTGCAGGTGG + Intergenic
1093034578 12:14320507-14320529 TCCCGCAATGGGGCTGCAGGTGG - Intergenic
1093189479 12:16057788-16057810 TCCCGCACCAGGGCTGCAGGTGG - Intergenic
1093266350 12:17008037-17008059 TCCCGCACTGGGGCTACAGGTGG - Intergenic
1093346325 12:18040624-18040646 TCCTGCACCAGGGCCGCAGGTGG - Intergenic
1093381636 12:18500558-18500580 TCTCGCATTGGGGCTGCAGGTGG - Intronic
1093527017 12:20115177-20115199 TCCCGCACCGGGGCTGCAGGTGG + Intergenic
1093580960 12:20783727-20783749 TCTTGCACTGGGGTTGCAGGTGG + Intergenic
1093653832 12:21673954-21673976 TCCCGCACCTGGGCAGCAGGTGG + Intronic
1093793796 12:23286341-23286363 TCCCGCACCGGGGCTGCAGGTGG - Intergenic
1093921744 12:24866513-24866535 TCTTGCACCAGGGCTGCAGGTGG - Intronic
1093970281 12:25369779-25369801 TCCCGCACAGGGGCTGCAGGTGG - Intergenic
1093973031 12:25391842-25391864 TCCTGCACCAGGGCTGCAGATGG - Intergenic
1094064628 12:26350043-26350065 CCCAGCACAGGGCTTGCAGGAGG + Intronic
1094338526 12:29386188-29386210 TCCCGCACCTGGGCTGCAGGTGG + Intergenic
1094409912 12:30157273-30157295 TCCCGCACCAGGGCTGCAGGTGG - Intergenic
1094448800 12:30562046-30562068 TCCCGCACCCGGGCTGCAGGTGG - Intergenic
1094589226 12:31805736-31805758 TCCCGCACCGTGGCTGCAGGTGG + Intergenic
1094661359 12:32472705-32472727 TCCCGCACCGGGGCTGCAGGTGG - Intronic
1094666560 12:32526085-32526107 TCCCGCACCGGGGCTGCAGGTGG - Intronic
1094718121 12:33033878-33033900 TCCCGCACCGGGGCTGCAGGTGG + Intergenic
1094842367 12:34347489-34347511 TCCCGCGCATGGGCAGCAGGGGG + Intergenic
1095123165 12:38442362-38442384 TCCCACACCAGGGCTGCAGGTGG - Intergenic
1095304211 12:40621025-40621047 TCCCTCACCGGGGCTGCAGGTGG - Intergenic
1095478574 12:42610894-42610916 TCCTGCACCAGGGCCGCAGGTGG + Intergenic
1095534035 12:43224693-43224715 TGCCACACTGGGGCTGCAGGTGG - Intergenic
1095642455 12:44500801-44500823 TCCCGCACCAGGGCCACAGGTGG - Intergenic
1095776776 12:46018430-46018452 TCCCGCACGGGGGCTGCAGGTGG - Intergenic
1096251023 12:50032835-50032857 TCCCGCGCGGGGGCGGCAAGCGG + Intronic
1096278519 12:50231583-50231605 AGCCCCACAGAGGCTGCAGGTGG + Intronic
1097017846 12:56000092-56000114 TCCCGCACTGGTGCTGCAGGTGG + Intronic
1097128864 12:56795786-56795808 TCCCGCACCGGGGCTGCAGGTGG + Intergenic
1097213001 12:57386682-57386704 TCCTGCACTGGGGCTGCAGGTGG - Intronic
1097664126 12:62461222-62461244 TCTCGCACCAGGGCCGCAGGTGG + Intergenic
1098168142 12:67719179-67719201 TCCCGCACAGGGGCTGCAGGTGG + Intergenic
1098498681 12:71166147-71166169 TCCCACACCGGAGCCGCAGGTGG + Intronic
1098588751 12:72185459-72185481 TCCCGCACAGGGGCTGCAGGTGG - Intronic
1098759317 12:74403361-74403383 TCCCACACCGGGGCTGCAGGTGG - Intergenic
1099191470 12:79565367-79565389 TCCCACACCGGGGCCACAGGTGG - Intergenic
1099192501 12:79574285-79574307 TCTCGCACTGGGGCCACAGGTGG - Intergenic
1099228082 12:79993169-79993191 TCCTGCACAGGGGTCACAGGTGG + Intergenic
1099413638 12:82361362-82361384 TCCCACGTTGGGGCTGCAGGTGG + Intronic
1099443894 12:82729136-82729158 TCCCGCACTGGGGCCACAGGTGG - Intronic
1099523869 12:83696242-83696264 TCCCTCACTGGGGCTGCAGGTGG + Intergenic
1099559549 12:84155070-84155092 TCCTGCACCAGGGCTGCAGGTGG + Intergenic
1099716158 12:86296349-86296371 TCCCACACCAGGGCTGCAGGTGG + Intronic
1100166546 12:91923855-91923877 TCCCACACCGGGGTTGCAGGTGG + Intergenic
1100392625 12:94157220-94157242 TCCCCAGCAGGTGCTGCAGGTGG + Intronic
1100584768 12:95969547-95969569 TCCCGCACCGGGGCTGCAGGTGG - Intergenic
1100600711 12:96109275-96109297 TCCCGCACCGGGGCTGCAGGTGG - Intergenic
1100734559 12:97512732-97512754 TCCCGCACCGGGGCTGCAGGTGG + Intergenic
1101009068 12:100430715-100430737 TCCCGCACCGGGGCTGCAGGTGG - Intergenic
1101021697 12:100559795-100559817 TCCGGCACCAGGGCTGCAGGTGG - Intronic
1101399195 12:104373322-104373344 TCCTTCACAGGGGCTGCTGGGGG - Intergenic
1101461890 12:104905459-104905481 TCCCGCACCGGGGCTGCAGGTGG + Intronic
1102309836 12:111836066-111836088 TCCTGCACCCGGGCCGCAGGTGG - Intergenic
1102387179 12:112519879-112519901 TCCTGCACCAGGGCTGCAGGTGG + Intergenic
1103146072 12:118597123-118597145 TCCCGCACCAGGGCTGCAGGTGG + Intergenic
1103439145 12:120950273-120950295 TCTCCCACTGGGGCTGCAGGTGG + Intergenic
1103459592 12:121093482-121093504 TTCCGCACGAGGGCCGCAGGTGG + Intergenic
1103497628 12:121374852-121374874 TCCCGCACAGGAGCTGCAGGTGG - Intronic
1103783316 12:123414060-123414082 TCCCGCACCGGGGCTGCAGATGG + Exonic
1103853362 12:123947374-123947396 TCCCACACCGGGGCTGCAGGTGG - Intronic
1104344572 12:127983798-127983820 TCCCGCACCAGGGCCGCAGGTGG - Intergenic
1104582715 12:130022468-130022490 TCCCGCACCGGGGCTGCAGGTGG - Intergenic
1104614442 12:130256601-130256623 TCCCGCACTGGGGTTGCAGGTGG + Intergenic
1104749317 12:131228225-131228247 TCCCGCACCGGGGCTGCAGGTGG - Intergenic
1105037826 12:132939167-132939189 TCCCGCACCGGGGCTGCAGGTGG - Intronic
1105426821 13:20301716-20301738 ACCCGCGGAGGGGCTGCTGGTGG - Intergenic
1105605095 13:21920649-21920671 TACCGCACTGGGGCAGCAGGTGG + Intergenic
1105722244 13:23127984-23128006 TCCCGCACTGGGGCTGCAGGTGG - Intergenic
1105876611 13:24560653-24560675 TCCTGCACCAGGGCTGCAGGTGG + Intergenic
1106221249 13:27748260-27748282 TCCCGCGCCGGGGCTGCAGGTGG + Intergenic
1106600485 13:31182999-31183021 TCCCTCACCAGGGCTGCAGGTGG + Intergenic
1106616991 13:31339612-31339634 TCCCACACTGGGGCTGCAGGTGG + Intergenic
1106643358 13:31608776-31608798 TCCCGCACCAGGGCTGCAGGTGG + Intergenic
1106811022 13:33358394-33358416 TCCCACACCGGGGCTGCAGGTGG - Intergenic
1107259309 13:38472377-38472399 TCCCGCACTGGGGCTGCAGGTGG + Intergenic
1107541314 13:41391797-41391819 TCACACACAGGGGCTGTTGGGGG - Intergenic
1107590389 13:41898526-41898548 TCCCGCACCAGGGCTGCAGGTGG + Intronic
1107603704 13:42039311-42039333 TCCAGCACTGGGACTACAGGCGG - Intergenic
1107694752 13:42989431-42989453 CCCCACACTGGGGCTGCAGGAGG + Intronic
1107836191 13:44413988-44414010 TCCCGCACCGAGGCTGCAGGTGG - Intergenic
1108099107 13:46936002-46936024 TCCCACACCAGGGCTGCAGGTGG + Intergenic
1108469384 13:50753254-50753276 TCCCGCACCAGGGCTGCAGGTGG + Intronic
1108643901 13:52408022-52408044 TCCCGCACCGGGGCTGCAAGTGG + Intergenic
1108686807 13:52826669-52826691 TCCCGCACCAGGGCTGTGGGTGG - Intergenic
1108751464 13:53452341-53452363 TCCCGCACCAGGGCTACAGGTGG + Intergenic
1108851542 13:54737223-54737245 TCCCGCACTGGGGCTGCAGGTGG + Intergenic
1108858884 13:54829447-54829469 TCCCGCACCGGGGCTGCAGATGG + Intergenic
1108996075 13:56735976-56735998 TCCCGCACAGGGGCTGCAGGTGG - Intergenic
1109007832 13:56901143-56901165 TCTGGCACTGGGGCTGCAGGTGG - Intergenic
1109110939 13:58318482-58318504 TCCCCCACTGGGGCTGCAGCTGG + Intergenic
1109124645 13:58504218-58504240 TCCCGCACCAGGGCTGCAGGTGG + Intergenic
1109141121 13:58714496-58714518 TCCCGCACCGGGGCTGCAGGTGG - Intergenic
1109145465 13:58773697-58773719 ATCCGCAGTGGGGCTGCAGGTGG - Intergenic
1109152042 13:58858803-58858825 TCCTGCACAAGGGCCCCAGGTGG + Intergenic
1109159800 13:58958129-58958151 TCCCGTACCGGGGCTGCAGGTGG + Intergenic
1109364704 13:61339573-61339595 TCCCTCACTGGGGCTGCAGGGGG - Intergenic
1109441439 13:62379642-62379664 TCCCGCACCGGGGCTGCAGGTGG - Intergenic
1109506219 13:63306145-63306167 TCTGGCACAGGGGCCGCAGGTGG - Intergenic
1109745890 13:66622362-66622384 TCCTGCACCGGGGCTGCAGGTGG - Intronic
1109854222 13:68107666-68107688 TCCTGCACTGGGGCCACAGGTGG + Intergenic
1110023997 13:70511858-70511880 TCCCGCACCAGAGCTGCAGGTGG + Intergenic
1110368947 13:74718801-74718823 TCCCGCACCGGGGCTGCAGGTGG - Intergenic
1110417551 13:75268862-75268884 TCCCATACTGGGGCTGCAGGTGG - Intergenic
1110609751 13:77475443-77475465 TCCCGCACAGGGGCCGCATGTGG + Intergenic
1110792330 13:79600105-79600127 TCCCGCACTGGGGCTGCAGGTGG + Intergenic
1110854123 13:80278600-80278622 TACCCCACTGGGGCCGCAGGTGG + Intergenic
1110862210 13:80355950-80355972 TCCCACACCGGGCCTGCAGGTGG - Intergenic
1110874288 13:80490504-80490526 TCCCGCACTGGGGCTGCAGGTGG + Intergenic
1110940218 13:81340718-81340740 TCCCGCACCGGGGCTACCGGTGG + Intergenic
1110999769 13:82164894-82164916 TCTCACACTGGGGCTGCAGGTGG + Intergenic
1111006717 13:82258372-82258394 TCTCGCACCGGGGCCACAGGTGG - Intergenic
1111220993 13:85205338-85205360 TCCCGCTCCGGGGCTGTGGGTGG - Intergenic
1111441977 13:88292233-88292255 TCCTGCACTGGGGCTGCAGGTGG - Intergenic
1111556101 13:89883813-89883835 TCCCGCACCAGCCCTGCAGGTGG + Intergenic
1111591104 13:90349012-90349034 TCCCGCATGGGGGCTGCAGGTGG - Intergenic
1111602794 13:90495185-90495207 TACCCCACTGGGGCTGCAGGTGG - Intergenic
1111748400 13:92297079-92297101 TCCCGCACAGGGGCTGCAGGTGG - Intronic
1111841337 13:93454733-93454755 TCCCGCACCCGGGCTGCAGGTGG + Intronic
1112077674 13:95931384-95931406 TCCCACACCTGGGCCGCAGGGGG + Intronic
1112226583 13:97545698-97545720 TCCCACATGGGGGCCGCAGGTGG - Intergenic
1112282626 13:98076282-98076304 TCCTGCACCCGGGCCGCAGGTGG + Intergenic
1112518718 13:100077929-100077951 TCCCACACCAGGGCTGCAGGTGG - Intergenic
1112533094 13:100223996-100224018 TCCCGCACCGGGGCTGCAGGTGG + Intronic
1112613175 13:100976109-100976131 TCCCGCACCGGGGCTGCAGGTGG - Intergenic
1112705926 13:102068887-102068909 TCCTGCACTGGGGCTGCAGGTGG - Intronic
1112842760 13:103600352-103600374 TCCCGCACCAGGGCTGCAGGTGG - Intergenic
1113371878 13:109732616-109732638 TCCCGCCCGGGGGCTGCAGGTGG + Intergenic
1113416190 13:110130511-110130533 TCCCATACAGGTGCTGAAGGTGG - Intergenic
1113482611 13:110632976-110632998 TCCCGCACCAGGGCTGCAGGTGG + Intronic
1113506707 13:110821573-110821595 TCCCACACCGAGGCTGCAGGTGG - Intergenic
1113538057 13:111083819-111083841 TCCCGCACCGGGGCTGCAGGTGG + Intergenic
1113587155 13:111473305-111473327 GCCCGCACACGGCCTGCAGTGGG - Intergenic
1113678126 13:112222130-112222152 TCCCACACCGAGGCTGCAGGTGG - Intergenic
1114560238 14:23584828-23584850 TCCTGCACCGGGGCTGCAGGTGG + Intergenic
1114568232 14:23647826-23647848 CCCAGCACAGGAGCTGGAGGTGG - Intergenic
1114593612 14:23892171-23892193 TCCCCCACCAGGGCTGCAGGTGG - Intergenic
1114957840 14:27845787-27845809 TCCCGCGCTGGGGCCGCTGGGGG - Intergenic
1115174514 14:30547455-30547477 TCCCGCCCCAGGGCTGAAGGCGG + Intergenic
1115925265 14:38425852-38425874 TCCCACACAGCTGCTGCTGGGGG + Intergenic
1116250959 14:42482332-42482354 TCCGGCACCGGGGCTGCAGGTGG + Intergenic
1116311079 14:43327016-43327038 TCCTGCACAGGGGCCGCAGGTGG - Intergenic
1116452436 14:45080849-45080871 TCCCGCTCTGGGGCTGCAGGTGG - Intergenic
1116624088 14:47242857-47242879 TCCCACACCGGGGCTGCAGGTGG - Intronic
1117077942 14:52122658-52122680 TCCCGCACCAGGGCTGCAGGTGG - Intergenic
1117297636 14:54393853-54393875 TCCCGCACCGGGGCTGCAGATGG - Intergenic
1117302590 14:54443465-54443487 TCCCACACCGGGGCTGCAGGTGG - Intergenic
1117449885 14:55839880-55839902 TCCCACACCAGGGCTGCAAGTGG - Intergenic
1117565703 14:56991430-56991452 TCCTGCACCAGGGCTGCGGGTGG - Intergenic
1117571853 14:57056563-57056585 TCCCGCACCGGGGCTGCAGGTGG + Intergenic
1118006391 14:61567915-61567937 CCCAGCACAGGGGCAGCAAGCGG - Intronic
1118215297 14:63803211-63803233 TCCCCCACCGGGGCTGCAGGTGG + Intergenic
1118306384 14:64658541-64658563 TACCGCACAGGGGCTACAGGTGG - Intergenic
1118616272 14:67576410-67576432 CACCTCACAGTGGCTGCAGGTGG + Exonic
1118932494 14:70255256-70255278 TCCCGCACAGGGGCCGCAGGTGG - Intergenic
1119027845 14:71167906-71167928 TCCCGCACTGGGGCCGCAGGTGG - Intergenic
1119038919 14:71254710-71254732 TCCCACACCGGGGCTGCAGATGG - Intergenic
1119161013 14:72452576-72452598 TCCAGCAGAGGGGCTTCATGAGG - Intronic
1119190774 14:72680364-72680386 TCCCGCCCCAGGGCTCCAGGAGG + Intronic
1119300249 14:73566280-73566302 TCGTGCACTGGGGCTGCAGGTGG + Intergenic
1119486854 14:74994562-74994584 TCCCGCACTGGGGCTGCAGGTGG - Intergenic
1119673370 14:76536697-76536719 TCCCGCACCGGGGCTGCAGGTGG + Intergenic
1119870634 14:78013927-78013949 TCCTGCAACAGGGCTGCAGGTGG + Intergenic
1120331052 14:83092794-83092816 TCCCGCACCGGTGCTGTAGGTGG - Intergenic
1120429682 14:84399334-84399356 TCCTGCACTGGGGCTGCAGGTGG + Intergenic
1120439034 14:84512855-84512877 TCCCACACCGGGGCTGCGGGTGG + Intergenic
1120704682 14:87734677-87734699 TCTCGCACCAGGGCCGCAGGTGG + Intergenic
1120844232 14:89112061-89112083 TTCTGCACGGGGGCTGCAGGTGG - Intergenic
1122216454 14:100208113-100208135 TCCTGCACTGGGGCTGGAGGTGG + Intergenic
1122446479 14:101773344-101773366 TCCAGCAGAGGGGCTGCCAGAGG - Intronic
1122493384 14:102135458-102135480 TCCCGCACCGGGGCTGCAGGTGG + Intronic
1122514610 14:102298102-102298124 TCCCACACCAGGGCTGCAGGTGG - Intronic
1122830578 14:104393676-104393698 CCCAGCAGAGGGGCCGCAGGAGG - Intergenic
1122894751 14:104751471-104751493 TCCCACACCGGGGCTGCAGGTGG + Intergenic
1122931119 14:104933473-104933495 TCCCGCCCCGAGGCTGCCGGGGG + Exonic
1123475638 15:20591268-20591290 TCCAGCACAAGGCCTGCAGGAGG + Intergenic
1123642373 15:22409095-22409117 TCCAGCACAAGGCCTGCAGGAGG - Intergenic
1123799216 15:23803327-23803349 TCCCGCACCTGGGCTGCAGATGG - Intergenic
1123949058 15:25253140-25253162 TCCCGCACTGGGGCTGCAGGTGG + Intergenic
1123999482 15:25742854-25742876 CTCAGCAGAGGGGCTGCAGGCGG - Intronic
1124036429 15:26057286-26057308 TCCTGCACTGGGGCCGCAGGTGG - Intergenic
1124114776 15:26831126-26831148 TCCCGCACCAGGGCTGCAGATGG + Intronic
1124573202 15:30884170-30884192 TCCCGCACCGGGGCTGCAGGTGG - Intergenic
1124818403 15:33019433-33019455 TCCTGCACCGGGGCCGCAGGTGG + Intronic
1125112290 15:36047366-36047388 TCCCGCACCGGGGCTGCAGGTGG - Intergenic
1125480217 15:40074720-40074742 TCCCGCAATGGGGCTGCAGGTGG + Intergenic
1125565681 15:40676874-40676896 TCCGGCCCAGGGGCTGCAGGTGG + Intergenic
1125609773 15:40962032-40962054 TCCCGCACCGGGGCTGCAGGTGG - Intergenic
1125681743 15:41535074-41535096 TCTGGCACAGGGACTCCAGGTGG + Intronic
1125885478 15:43226535-43226557 TCCCGCACTGGGGCCGCAGGTGG + Intergenic
1125914483 15:43473819-43473841 TCTCGCACGGGGGCTGCAGGTGG + Intronic
1126089065 15:45035248-45035270 TCTCGCACTGGGGCTGCAGGTGG - Intronic
1126128158 15:45314511-45314533 TCCCGCATGGGGGCTGCAGGTGG - Intergenic
1126639746 15:50812382-50812404 TCCCGCATCGGGGCCACAGGTGG - Intergenic
1127765993 15:62186511-62186533 TCCTGCACCAGGGCTGCAGGTGG + Intergenic
1127984857 15:64061299-64061321 TCCCCCACCAGGGCCGCAGGTGG - Intronic
1128110915 15:65075438-65075460 TCCTGCACCAGGGCTGCAGGTGG - Intronic
1128133967 15:65249305-65249327 CCCCGCCCAGGGGCTGCCTGGGG - Intronic
1128140980 15:65301013-65301035 TCCTCCACTGGGGCCGCAGGTGG + Intergenic
1128598497 15:68975616-68975638 CCCCGCACCGGGGCTGCAGGTGG + Intronic
1128669911 15:69567305-69567327 TCCCGCACCAGGGCTGCAGGTGG + Intergenic
1128678630 15:69629986-69630008 ACCCTCAGAAGGGCTGCAGGTGG - Intergenic
1128813234 15:70587121-70587143 TCCCGCACCAGGGCTGCAGGTGG + Intergenic
1129158191 15:73732132-73732154 TCCCCCACCGGGACTACAGGTGG + Intergenic
1129196995 15:73974122-73974144 TCCCACACGGGGGCTGCAGGTGG - Intergenic
1129208705 15:74052913-74052935 TCCCGCACGGGGGCCGCAGGTGG - Intergenic
1129280320 15:74480291-74480313 TCCCACACCTGCGCTGCAGGTGG + Intergenic
1129373941 15:75115943-75115965 TCCTGCACCGGGGCTGCAGGTGG + Intronic
1129472651 15:75764020-75764042 CCCTGCAGTGGGGCTGCAGGGGG - Intergenic
1129777429 15:78246084-78246106 TCCCGCACCCGGGCTGCAGGTGG + Intergenic
1129789592 15:78331815-78331837 TCCCTCACTGGAGCTGCAAGAGG + Intergenic
1129859242 15:78847287-78847309 TCCCGCACGGGGGCTGCAGGTGG - Intronic
1129986965 15:79926488-79926510 TCCTGCACCGGGGCTGCAAGTGG - Intergenic
1129997216 15:80016891-80016913 TCCCGCACTGGGGCTGCAGGTGG - Intergenic
1130132940 15:81159035-81159057 TCCCGCACCGGGGCTGCAGGTGG - Intergenic
1130233448 15:82113823-82113845 TTCCCCAGAGGGGCTGCAGTGGG + Intergenic
1131012631 15:89031646-89031668 TCCCGCACCGGGGCCGCAGGTGG + Intergenic
1131507859 15:93032241-93032263 TCCCGCACCGGGGCTGCAGGTGG - Intergenic
1131846037 15:96491779-96491801 TCCCGCACCGGGGCTGCAGGTGG + Intergenic
1131892114 15:96984121-96984143 TACTGCACAGGGGCCGCAGGTGG + Intergenic
1131992315 15:98104212-98104234 TCCTGCACCGGGGCGGCAGGTGG + Intergenic
1132044276 15:98550126-98550148 TCCTGCACGGAGGCCGCAGGTGG - Intergenic
1132097771 15:99000417-99000439 TCCCGCACTGGGGCCGTAGGTGG - Intronic
1132098804 15:99008223-99008245 TCCCGCACCAGGGCCGCAGGTGG + Intergenic
1132232429 15:100193881-100193903 TCCCGAGGAGAGGCTGCAGGAGG + Intronic
1132511089 16:341657-341679 TCCCGCACCGGGGTTGCAGGTGG - Intronic
1132574214 16:657228-657250 TCCCCCAGAGTGGCTGCAGGGGG - Intronic
1132579812 16:679808-679830 TCACGCGCAGGGGCGGGAGGCGG + Intronic
1132598961 16:765471-765493 TCCCTCTCTGGGGCTGCACGTGG + Intronic
1132722828 16:1325418-1325440 GCCCGCGGTGGGGCTGCAGGTGG - Exonic
1132836742 16:1958147-1958169 TCCCGCACGGGGGCTGCAGGTGG + Intergenic
1133197527 16:4182010-4182032 CCCAGCACAGAGGCTGCAGCGGG + Intergenic
1133352093 16:5108498-5108520 TCCCGCCCTGGGGCCACAGGTGG + Intergenic
1133362584 16:5186311-5186333 TCCCGCACCGGGGCTGCAGGTGG + Intergenic
1133367461 16:5221957-5221979 TTCTGCACCGGGGCCGCAGGTGG + Intergenic
1134009640 16:10842463-10842485 ACCCCCACAGGGGCTTCTGGGGG - Intergenic
1134678073 16:16104615-16104637 TGCCACACTGGGGCTGCAGGTGG + Intronic
1135262050 16:20989589-20989611 TCCCGCACCGGGGCTGCAGGTGG + Intronic
1135280932 16:21153011-21153033 TCCTGCACCGGGGCTGCAGGTGG - Intronic
1135299321 16:21312727-21312749 TCCCGCACCAGGGCTGCAGGTGG + Intergenic
1135942627 16:26836046-26836068 TCCTGCACCAGGGCCGCAGGTGG + Intergenic
1136163370 16:28435782-28435804 TCCCGCACCGGGGCTGCAGGTGG - Intergenic
1136199593 16:28679205-28679227 TCCCGCACCGGGGCTGCAGGTGG + Intergenic
1136215939 16:28793378-28793400 TCCCGCACCGGGGCTGCAGGTGG + Intergenic
1136655522 16:31706881-31706903 TCCAGTACTGGGGCTGCAGAGGG - Intergenic
1137300504 16:47143912-47143934 TCCCGCGCCGGGGCCGCGGGCGG - Exonic
1137442585 16:48509101-48509123 TCCCGCACCGGGGCCGCAGGTGG - Intergenic
1138688862 16:58749270-58749292 TCCCGCACCACGGCCGCAGGTGG - Intergenic
1138693529 16:58790716-58790738 TCCCACACCGGGGCTGCAGGTGG + Intergenic
1139051552 16:63130046-63130068 TCCCGCAGGGGGACTGCAGGTGG - Intergenic
1139125466 16:64072275-64072297 TCCCGCACCAGGGCTGCAGATGG + Intergenic
1139147810 16:64344306-64344328 TCTCGCATTGGGGCTGCAGGTGG - Intergenic
1139223676 16:65212624-65212646 ACCCTCACTGGGGCTGGAGGAGG + Intergenic
1139229857 16:65273243-65273265 TCTGGCTCAGTGGCTGCAGGTGG + Intergenic
1139442378 16:66974642-66974664 TCCAGCACTGGGGCAGCAGGTGG - Exonic
1139600356 16:67982636-67982658 TGCTGCACCGGGGCCGCAGGTGG - Intergenic
1139603129 16:67998629-67998651 TCCCGCACCAGGGATGCAGGTGG - Intronic
1139676483 16:68527114-68527136 TCCCGCACCGGGGCTGCAGTTGG - Intergenic
1140722446 16:77784331-77784353 TCCCGCATGGGGGCTGCAGGTGG + Intergenic
1140889438 16:79272416-79272438 ACACGCACAGGGCCTCCAGGGGG - Intergenic
1141465669 16:84204562-84204584 TCCCGCACCGGGGCTGCAGGTGG + Intergenic
1141702501 16:85648919-85648941 ACCCGCACAGGGCCTCCAGGAGG - Intronic
1141837756 16:86553768-86553790 TCCCGCACTGGGGCTGCAGGTGG - Intronic
1141920874 16:87134545-87134567 TCCCCTTCAGGGGCTGGAGGAGG + Intronic
1142197361 16:88745041-88745063 GCGGGGACAGGGGCTGCAGGTGG - Intronic
1142240543 16:88942620-88942642 CGCTGCCCAGGGGCTGCAGGAGG - Intronic
1142505740 17:362007-362029 TCCCGCACCGGGGCTGCAGGTGG - Intronic
1143135203 17:4709043-4709065 TCCCGCTTGGGGGCCGCAGGTGG + Intergenic
1143283439 17:5771630-5771652 TCCCGCACCGGGGCCGCACGTGG - Intergenic
1143460444 17:7100539-7100561 TCCTGCACTGGGGCCGCAGGTGG + Intergenic
1143619266 17:8071895-8071917 CCCCCCACAGGAGCAGCAGGGGG - Intergenic
1143664202 17:8347065-8347087 TCCCACACCGGGGCTGCAAGTGG + Intergenic
1143708579 17:8718024-8718046 TCCCGCACTGGGGCCACAGGTGG + Intergenic
1143775419 17:9195795-9195817 TCCTGCTCTGGGGCTGGAGGGGG - Intronic
1143780231 17:9225445-9225467 GCCCCCACAGGGGCTGGCGGGGG + Intronic
1144467221 17:15506102-15506124 TCCCGCACCGGGGCTGCAGGTGG - Intronic
1144723279 17:17486766-17486788 TCCCGCACCGGGGCTGCAGGTGG - Intronic
1144763054 17:17718134-17718156 TCCCGACCAGGGGAAGCAGGGGG - Intronic
1144955670 17:19017712-19017734 TCCTGCACAGGGTTTCCAGGAGG - Intronic
1145905062 17:28511756-28511778 TCCCGACCAAGGACTGCAGGAGG - Intronic
1146224645 17:31054949-31054971 TCAAGCACAGAGGATGCAGGAGG + Intergenic
1146459314 17:33033245-33033267 CCCCGCCCAGGAGCTACAGGAGG - Intronic
1146740386 17:35278860-35278882 TCCCCCACCAGGGCAGCAGGTGG + Intergenic
1147156804 17:38548080-38548102 TCCCGCACTGGAGCTGGGGGTGG + Intronic
1147431887 17:40376243-40376265 TCCCGCACCAGGGCTGCAGGTGG - Intergenic
1147558872 17:41496903-41496925 TCCTGCCCAGGCCCTGCAGGGGG - Intergenic
1147997606 17:44369217-44369239 TCCCGCACAGGGGCTGCAGGTGG - Intergenic
1148016948 17:44528387-44528409 TCCTGCACCGGGGCTGCAGGTGG - Intergenic
1148023443 17:44568598-44568620 TCCCGCATCGGGGCCACAGGTGG - Intergenic
1148366107 17:47057231-47057253 TCCCGCACTGGGGCGGCAGGTGG + Intergenic
1148907981 17:50923302-50923324 TCCCCCACACAGGCTGCAGCAGG + Intergenic
1149099188 17:52883922-52883944 TGCCGCACCAGGGCCGCAGGTGG + Intronic
1149916477 17:60614052-60614074 TCCCGCACCGGGGCCGCAGGTGG - Intronic
1150778353 17:68099694-68099716 TCCCCCACCGGGGCTGCAGGTGG - Intergenic
1150786688 17:68169305-68169327 TCCTGCACCGGGGTTGCAGGTGG + Intergenic
1150788349 17:68180266-68180288 TCTCGCACGGGGGCCACAGGTGG - Intergenic
1150792306 17:68208227-68208249 TCCCGCACTGGGGCCGCAGGTGG - Intergenic
1150804536 17:68308859-68308881 TCCCGCACCGGCGCTGCAGGTGG + Intronic
1151262950 17:72930990-72931012 TGCTGCACTGGGGCTGCACGTGG + Intronic
1151567393 17:74906990-74907012 TCCTGCACCGGGGCCGCAGGTGG + Intergenic
1151756093 17:76076086-76076108 TCGCGCTCAGTGGCTACAGGAGG - Intronic
1151782599 17:76257594-76257616 TCCCGCACTGGGGCTGCAGGTGG + Intergenic
1151966519 17:77434360-77434382 GTCCGCACAGGGTCTGCTGGTGG + Intronic
1152618971 17:81351980-81352002 TCTCGCACTGGGGCTGCAGGTGG + Intergenic
1152630325 17:81408087-81408109 AGCCACACAGGGGCAGCAGGAGG - Intronic
1152740848 17:82017737-82017759 GCCCGCTCGGGGGCAGCAGGAGG - Intergenic
1152745871 17:82038795-82038817 TCCCGCATAAGGGCTGCTTGAGG + Intergenic
1153070459 18:1098645-1098667 TCCCGCACAGGGGCCACAGGTGG - Intergenic
1153643981 18:7178613-7178635 TCCCCCACCGGGGCCACAGGTGG + Intergenic
1153832389 18:8935370-8935392 TCCCGCACCAGGGCTGCAGGTGG + Intergenic
1154057165 18:11023596-11023618 TCCCGCACCGGGGCGGCAGGTGG + Intronic
1154128688 18:11716893-11716915 TCCCGCACGGGGGCTGCAGGTGG + Intronic
1154162967 18:11993695-11993717 TCCAGCACAGCTGCTCCAGGAGG - Intronic
1154231083 18:12557093-12557115 TCCCGCGTTGGGGCTGCGGGTGG + Intronic
1155207973 18:23577576-23577598 TCCCGCACCGGGGCTGCAGGTGG + Intronic
1155294961 18:24376526-24376548 TCCCGCACTGGGGCTGCAGGTGG + Intronic
1155611640 18:27673835-27673857 TCTCGCACCAGGGCTGCAGGTGG + Intergenic
1155772946 18:29723931-29723953 TCCCACACCGGGGCTGCAGGTGG - Intergenic
1155852348 18:30788859-30788881 TCCCACACCAGGGCTGCAGGTGG - Intergenic
1155856307 18:30839105-30839127 TCCCTCACTGGGGCTGCAGGTGG + Intergenic
1156038744 18:32794987-32795009 TCCCGCACCGGGGCTGCAGGTGG - Intergenic
1156079565 18:33316571-33316593 TCTCCCACTGGGGCGGCAGGTGG - Intronic
1156150386 18:34234257-34234279 TCCAGCACAGGGGCCGCAGGTGG - Intergenic
1156863728 18:41866171-41866193 TCCCGCACCGGGGCTGCAGGTGG - Intergenic
1156943241 18:42795643-42795665 TCCCGCACCCGGGCTGCAGGTGG - Intronic
1156969747 18:43139933-43139955 TCCCGCACTGGGGCCACAGGTGG - Intergenic
1157086039 18:44581147-44581169 TCCCACACCGGGGCTGCAGGTGG - Intergenic
1157749271 18:50163572-50163594 TCCAGCACCTGGGCTGCTGGTGG - Intronic
1157856834 18:51111790-51111812 TCCCGCACCGGGGCCGCAGGTGG + Intergenic
1157935118 18:51864312-51864334 TCCTGCACTGGGGCCACAGGCGG + Intergenic
1157979727 18:52366850-52366872 TCCCGCACCAGGGCTGCAGGTGG + Intronic
1158282237 18:55840653-55840675 TCCTGCACCAGGGCCGCAGGTGG + Intergenic
1158460665 18:57643606-57643628 TCCTGCACCAGGGCCGCAGGTGG + Intergenic
1158553956 18:58459788-58459810 TCCCGCACCGGTGCTGCACGTGG - Intergenic
1158697187 18:59714039-59714061 TCCCGCACCGGGGCTGCAGGTGG + Intergenic
1158705681 18:59790402-59790424 TCCCGCACCGGGGCTGCAGGTGG + Intergenic
1159167882 18:64725586-64725608 TCCCGCACTGGGGCTGCAGGTGG + Intergenic
1159230879 18:65605667-65605689 TCCCGCACCGGGGCTGCAGATGG - Intergenic
1159260415 18:66005915-66005937 CACCGCACCGGGGCTGCAGGTGG + Intergenic
1159472872 18:68879942-68879964 TCCCGCACCAGGGCTGCAGGTGG + Intronic
1159656032 18:71031284-71031306 TCCCGCACCAGGGCTGCAGGTGG + Intergenic
1159670087 18:71212342-71212364 TCCTGCACCGGGGCTGCAGGGGG + Intergenic
1159744031 18:72209541-72209563 TCCTGCACCGGGGCAGCAGGTGG - Intergenic
1160087050 18:75786326-75786348 TTCCCCACAGAGCCTGCAGGAGG - Intergenic
1160176545 18:76600077-76600099 TCCCGCACCGGGGCTGCAGGTGG + Intergenic
1160198629 18:76777658-76777680 TCCCGCACCGGGGCTGCAGGTGG - Intergenic
1160199999 18:76788522-76788544 TCCCGCACCAGGGCCACAGGTGG + Intergenic
1160536721 18:79598365-79598387 TGCCGGGCAAGGGCTGCAGGAGG + Intergenic
1160582087 18:79888570-79888592 AACCGCACAGCGGCTTCAGGAGG - Intronic
1160923045 19:1529506-1529528 TCCCAGCCCGGGGCTGCAGGTGG + Intronic
1160962653 19:1730421-1730443 TCCCGCTCAGGGGCTCTTGGTGG + Intergenic
1160994667 19:1877114-1877136 CCCCACCCAGGGGCTGCATGTGG - Exonic
1161454704 19:4364108-4364130 TCTCGCACAGGTTCTGGAGGGGG + Exonic
1161545120 19:4875837-4875859 GTCCGCAGAGGGTCTGCAGGGGG + Intergenic
1162107071 19:8376178-8376200 TCCTGCACCGGGGCTGCAGGTGG - Intronic
1162230218 19:9259927-9259949 TCCTGCACCGGGGCTGCAGGTGG - Intergenic
1162233034 19:9283399-9283421 TCCCGCACTGGGGCTGCAGGTGG + Intergenic
1162237821 19:9322010-9322032 TCTTGCACTGGGGCTGCAGGTGG - Intergenic
1162261986 19:9541273-9541295 TCCCGCACTGGGGCTGCAGGTGG + Intergenic
1162632630 19:11941242-11941264 TCCTGCACCAGGGCTGCAGGTGG + Intronic
1162814652 19:13186650-13186672 TCCTGCACCGGGGCTGCAGGTGG + Intergenic
1162974932 19:14203200-14203222 CCCCACAGAGGGGCTGGAGGAGG + Intronic
1162987170 19:14278020-14278042 TCCCGCACCAGGGCAGCAGGTGG - Intergenic
1163181653 19:15608593-15608615 TCCCGCAGCAGGGCTGCAGGTGG + Intergenic
1163218923 19:15900097-15900119 TCCCGCACCGGGGCTGCAGGTGG - Intergenic
1163721334 19:18899578-18899600 GCCCCCAGAGGGGATGCAGGTGG + Exonic
1164143960 19:22498935-22498957 TCCCGCACCGGGGCTGCAGATGG + Intronic
1164270520 19:23668474-23668496 TCCCGCACCGGGGCTGCAGGTGG + Intronic
1164590665 19:29505153-29505175 TCAGGCCCAGGAGCTGCAGGGGG - Intergenic
1164975866 19:32571998-32572020 TCCCTCACCGGGGCTGCAGGTGG - Intergenic
1165036454 19:33037015-33037037 TCCCACACCAGGGCCGCAGGTGG - Intronic
1165266994 19:34668559-34668581 TCCCGCACCGGGGCCACAGGTGG - Intronic
1165329485 19:35133685-35133707 TCACTCACAGGTACTGCAGGTGG + Exonic
1165415462 19:35691043-35691065 TCCCGCACTGGGGCTGCAGGTGG + Intergenic
1165846653 19:38821881-38821903 TCCTGCACCAGGGCCGCAGGCGG - Intronic
1166036145 19:40170087-40170109 TCCCGCACTGGGGCTGCAGGTGG + Intergenic
1166486940 19:43221868-43221890 TCCCACACTGGGGCTGCAGATGG + Intronic
1166649663 19:44563188-44563210 TCTCGCACCGGGGCTGCAGGTGG + Intergenic
1166871324 19:45872765-45872787 TCAGGCTCAGGGGCTGGAGGCGG - Exonic
1167251931 19:48403811-48403833 TCCCTCTCAGTGGCTGCTGGGGG + Intronic
1167674735 19:50877314-50877336 ACCAGCATGGGGGCTGCAGGAGG - Intronic
1168294969 19:55373841-55373863 CCCCGCAGTGTGGCTGCAGGAGG + Intergenic
1168652175 19:58098205-58098227 TCGCGCACTGGGGCTCCGGGCGG - Intronic
924967444 2:91403-91425 ACCCACACTGGGGCAGCAGGTGG - Intergenic
925088620 2:1134672-1134694 TCCCCCACCGGGGCTGCAGGTGG + Intronic
925098904 2:1229545-1229567 TCCGGCACCGGGGCTGCAGGTGG + Intronic
925537737 2:4935261-4935283 TCCCGCACCGGGGCTGCAGGTGG + Intergenic
926097562 2:10091831-10091853 TGTCGCACCAGGGCTGCAGGTGG - Intergenic
926133309 2:10319123-10319145 TCCCGTGCTGGGGCAGCAGGAGG - Intronic
926616558 2:15002481-15002503 TCCCGCACCGGGACTGCAGGTGG + Intergenic
926685770 2:15696721-15696743 TCCTGCACTGGGGTCGCAGGTGG + Intronic
926850719 2:17193925-17193947 TCCGGCACAGGGGCTGCAGGTGG - Intergenic
927181026 2:20446933-20446955 CCCCGCCCTCGGGCTGCAGGGGG + Intergenic
927357148 2:22186712-22186734 TCCCGCACTGGGGCCGCAGGTGG - Intergenic
927777865 2:25915875-25915897 TCCCCCACGGGGGCTGCAGGTGG - Intergenic
927900477 2:26814773-26814795 TCCCGCACCAGGGCTGCAGGTGG - Intergenic
927942122 2:27111460-27111482 TCCTGCACCGGGGCCGCAGGTGG + Intronic
928106425 2:28473045-28473067 TCCTGCACTGGGGCCGCAGGTGG - Intronic
928364006 2:30687786-30687808 TCCTGGACAGGGGCTGCATTAGG + Intergenic
928370211 2:30735098-30735120 CCCAGCACAGGGGCAGAAGGTGG + Intronic
928753268 2:34494707-34494729 TCCCGCACCAGGGCTGCAGGTGG - Intergenic
928936973 2:36688674-36688696 TCCCGCACCGGGGCTGCAGAGGG - Intergenic
929109936 2:38397676-38397698 TCCCACACCAGGGTTGCAGGTGG - Intergenic
929201928 2:39244689-39244711 TCCCGCACAGGGGCTGCAGGTGG - Intergenic
929233782 2:39585769-39585791 TCCCGCACCGGGGCTGCAGGTGG - Intergenic
929379761 2:41336004-41336026 TCCCGCACCAGGGCTGCAGGTGG - Intergenic
929556781 2:42930474-42930496 TCCTGCTCAGGGGCTGCATGAGG + Intergenic
929890794 2:45917617-45917639 TCCCGCACTGGGGCTGCAGGTGG + Intronic
930038087 2:47100146-47100168 TCCCACACCAGGGCTGCAGGTGG - Intronic
930039287 2:47107693-47107715 TCCCGCACCAGGGCTGCAGGTGG - Intronic
930186477 2:48417177-48417199 TCACGCTCAGGGTCTGAAGGGGG - Intergenic
930420809 2:51151561-51151583 CCCCACACTGGGGCTGCAGGTGG + Intergenic
930468158 2:51780282-51780304 TCCTGCACCGGGGCTGCAGGTGG + Intergenic
930485585 2:52007222-52007244 TCCCAAACCGGGGCTGCAGGTGG - Intergenic
931708763 2:64969418-64969440 TCCCACTCTGGGGCTGCAGGTGG - Intergenic
932240001 2:70148719-70148741 TCCCACACTGGGGCTGCAGGTGG - Intergenic
932359452 2:71092434-71092456 TCCTGCATGGGGGCTGCAGGTGG + Intergenic
932521846 2:72422240-72422262 TCCCGCACTGGGGCTGCAGGTGG - Intronic
932902119 2:75711988-75712010 TCCCGCACCGGGGCTGCAGGTGG - Intergenic
933060770 2:77734726-77734748 TCCGGCACCGGGGCCGCAGGTGG + Intergenic
933442026 2:82326230-82326252 TCCCGCACCGGGGCTGCAGGTGG + Intergenic
933487181 2:82938388-82938410 TCCCGCACCAGGGCTGCAGGTGG + Intergenic
933506385 2:83181413-83181435 TCCCGCACCGGGGCCGCAGGTGG - Intergenic
933511396 2:83245913-83245935 TCCCGCATGGGGGCTGCAGGTGG + Intergenic
933712087 2:85334360-85334382 TCCCGCACTAGGGCCGCAGGTGG + Intergenic
934479463 2:94622147-94622169 TCCCGCGCTGGGGCCGCTGGGGG + Intergenic
934765269 2:96876895-96876917 ACCAGCACAGGGGCTGAAGTTGG + Intronic
934898565 2:98139416-98139438 TCCCACACAGGGGCTTCAGGTGG - Intronic
935190436 2:100773727-100773749 TCTCTCACTGGGGCTGCAGGAGG - Intergenic
935196442 2:100819619-100819641 TCCCGCGCAGGGGATGAAGGGGG - Intergenic
935860161 2:107320848-107320870 CACTGCTCAGGGGCTGCAGGTGG - Intergenic
935866511 2:107392701-107392723 TCTCACACAGGGGCCGCAGGTGG - Intergenic
935878293 2:107536037-107536059 TCCCGCATGGGAGCTGCAAGTGG + Intergenic
935896772 2:107747287-107747309 TCCCGCACCGGGGCTGCAGGTGG + Intergenic
936172638 2:110190179-110190201 TCCCGCACCAGGGCTGCAGGTGG + Intronic
936346962 2:111682264-111682286 TCCTGCACCGGGGCTGCAGGTGG - Intergenic
936581449 2:113704369-113704391 TCCCGCACAGGGGCCACAGGTGG + Intergenic
937181205 2:119997400-119997422 TCTCGCACTGGGGCTGCAGGTGG - Intergenic
937209524 2:120259697-120259719 TCCCGCACCGGGGCTGCAGGTGG + Intronic
937596920 2:123684189-123684211 TCCCACACCGGGGCTGCAGGTGG - Intergenic
937711775 2:124987357-124987379 TCCTGCACCGGGGATGCAGGTGG + Intergenic
937746667 2:125422662-125422684 TCCCACACTGGGGCTGCAGGTGG - Intergenic
937979608 2:127607292-127607314 CCCTGCACAGGGCCTGCAGCTGG - Exonic
938124393 2:128661452-128661474 TCCGGGGCAGAGGCTGCAGGTGG - Intergenic
938126007 2:128672069-128672091 TCCTGCACCGGGGCTGCAGGTGG + Intergenic
938401096 2:130991858-130991880 TCCCGCACCGGGGCTGCAGGTGG - Intronic
938725958 2:134109293-134109315 TCCTGCAGCGGGGCGGCAGGTGG + Intergenic
939003199 2:136758834-136758856 TCCCGCACAGGGGCCGCAGGTGG - Intergenic
939053146 2:137331554-137331576 TCCAGCACTGGGGCTGCAGGTGG + Intronic
939229836 2:139410755-139410777 TCCCGCACCGGGGCTGCAGGTGG - Intergenic
939275131 2:139990640-139990662 TCTCTCACTGGGGTTGCAGGTGG + Intergenic
939281826 2:140074193-140074215 TCCCGTACCTGGGCTGCAGGTGG - Intergenic
939738699 2:145880850-145880872 TCCCGCACTGGGGCTGCAGGTGG + Intergenic
939745349 2:145960520-145960542 TCCCACACCAGGGCCGCAGGTGG + Intergenic
939777288 2:146403638-146403660 TCCCGCACTGGGGCTGCAGGTGG + Intergenic
939972476 2:148678347-148678369 TCCCGCACCAGGGCTGCAGATGG + Intronic
940112589 2:150171048-150171070 TCCCGAACTGGGGCCGCAGGTGG + Intergenic
940145591 2:150542269-150542291 TCTCACACAGGGGCTGCAAGTGG + Intergenic
940215165 2:151296370-151296392 TCCTGCACGGGGGCCGCAGGTGG - Intergenic
940666633 2:156617981-156618003 TCCCGCACTGGGGCTGCAGGTGG + Intergenic
940784537 2:157967861-157967883 TCCCCCACGGAGCCTGCAGGTGG + Intronic
941178995 2:162235328-162235350 TCTCGCACCGGAGCCGCAGGTGG - Intronic
941309321 2:163909938-163909960 TCCCGCACTGGGGCCACAAGTGG - Intergenic
941309857 2:163914031-163914053 TCCCGCACCAGGGCTGCAGGTGG - Intergenic
941397857 2:164994701-164994723 TCCCGCACGGGGGCTGCAGGTGG + Intergenic
941705800 2:168657385-168657407 TCCCGCACCGGGGCTGCAGGTGG + Intronic
941712048 2:168724844-168724866 TCCCCCACCGGGGCTGCAGGTGG + Intronic
941820863 2:169841947-169841969 TCCCGCACCGGGGCTACAGGTGG - Intronic
942170184 2:173282539-173282561 TCTCGCACAGGGGCCACAGGTGG + Intergenic
942317521 2:174709516-174709538 TCTCGCACCGGGGCCGCAGGTGG + Intergenic
942540262 2:177008264-177008286 TCCCACACCAGGGCCGCAGGTGG - Intergenic
942867359 2:180691801-180691823 TCCTGCACGGGGGCTGCAGGTGG - Intergenic
943106090 2:183546625-183546647 TCCTGCACTGGGGCAGCAGGTGG + Intergenic
943494674 2:188606341-188606363 TCCCGCACCAGGGCTGCAGGTGG + Intergenic
943790103 2:191922001-191922023 TCCCGCACCGGGGCCGCAGGTGG - Intergenic
943835226 2:192508382-192508404 TCCCGCACTGGGGCTGCAGGTGG - Intergenic
943906051 2:193502408-193502430 TCCTGCACCCGGGCAGCAGGTGG + Intergenic
943941382 2:194002704-194002726 TCCCGCTTTGGGGCCGCAGGTGG + Intergenic
943942795 2:194020574-194020596 TCCCACACTGGGGCCACAGGTGG - Intergenic
943955024 2:194176777-194176799 TCTCCCACTGGGGCTGCAGGTGG - Intergenic
944058420 2:195547298-195547320 TCTCACACTGGGGCCGCAGGTGG + Intergenic
944252418 2:197591501-197591523 TACTGCACTGGGGCGGCAGGTGG + Intronic
944487894 2:200225745-200225767 TCCAGCTCACAGGCTGCAGGGGG + Intergenic
944729711 2:202503784-202503806 TCCCACACCTGGGCTGCAGGTGG - Intronic
944857859 2:203785520-203785542 TCCCGCACCGGGGCTGCAGGTGG + Intergenic
945401456 2:209387748-209387770 TCTCGCACTGGGGCTGCAGGTGG - Intergenic
945451425 2:210000563-210000585 TCCCATACTGGGGCGGCAGGTGG + Intergenic
945575402 2:211524324-211524346 TCCCTCACGGGGGCTGCAGGTGG + Intronic
945664150 2:212721016-212721038 TCCTGCGCTGGGGCCGCAGGCGG + Intergenic
945745852 2:213718905-213718927 TCCCGCACCAGGGCTGCAGGTGG - Intronic
945870288 2:215219476-215219498 TCTCACACTGGGGCTGCAGGTGG - Intergenic
945872759 2:215245687-215245709 TCCCGCACCGGGGCTGCAGGTGG + Intergenic
946054064 2:216885637-216885659 TACCACACTGGGGCTGCAGGTGG - Intergenic
946358014 2:219201374-219201396 TACCGCACCGTGGCTGCAGGTGG + Intronic
946376570 2:219313190-219313212 TCCCACACCGGGGCCGCAGGTGG - Intergenic
946923491 2:224603648-224603670 TTCCGCACCAGGGCTGCAGATGG + Intergenic
946982093 2:225229395-225229417 TCCCGCATCGGGGCTGCAGGTGG + Intergenic
947026706 2:225744547-225744569 TCCCGCACCAGGGCTGCAGGTGG - Intergenic
947412062 2:229851130-229851152 TCCTGCACCGGGGCTGCACGTGG - Intronic
947720500 2:232366754-232366776 TTCCGCACCGGGGCTGCAGGTGG - Intergenic
947931985 2:233972415-233972437 TCCCGCACCGCGGCTGCAGGTGG + Intronic
947962121 2:234248089-234248111 TCCCGCACCAGGACCGCAGGCGG - Intergenic
948125796 2:235563990-235564012 TCCCACAAAGAGGCTCCAGGAGG - Intronic
948449040 2:238057800-238057822 TCCCCCACTGCGGCTGCAGGTGG + Intronic
948515840 2:238503479-238503501 TCCCGCCCAGGGGCTGAGTGAGG + Intergenic
948899809 2:240950571-240950593 CCCAGCACAAGGGCTGCATGTGG + Intronic
1169645282 20:7803506-7803528 TCCCGCAGGAGAGCTGCAGGTGG + Intergenic
1169814384 20:9641536-9641558 TCCCGCACCGGGGCTGCAGGTGG + Intronic
1169849261 20:10032092-10032114 TCCCGCACGAGAGCTGCAGGTGG - Intronic
1170230814 20:14044775-14044797 TCCCGCACTGGGGCTGCAGGTGG + Intronic
1170246541 20:14226920-14226942 TCCTGCACTGGGGCTGCAGGTGG - Intronic
1170649572 20:18227178-18227200 TCCAGCACCAGGGCAGCAGGTGG - Intergenic
1170806776 20:19639575-19639597 TCCCGCACTGGGGCTGCAGGTGG + Intronic
1170989964 20:21292293-21292315 TCCCGCACCGGGGCTGCAGGTGG - Intergenic
1171318777 20:24220668-24220690 TCCCACACCGGGGCTGCAGGTGG + Intergenic
1171973346 20:31578515-31578537 TCCCGCACAGGGGCTGCAGGTGG + Intergenic
1172270235 20:33651140-33651162 TACCACCCAGGGGCTGCTGGAGG - Intergenic
1172431780 20:34898748-34898770 TCCCGCACTGGGGCTGCAGGTGG + Intronic
1173195458 20:40910416-40910438 TCCCGCACTGGGGCTGCAGGTGG + Intergenic
1173195760 20:40911597-40911619 TCCCGCACTGGGGCTGCAGGTGG - Intergenic
1173601670 20:44299548-44299570 TCCCGCACCGGGGCTGCAGGTGG - Intergenic
1173778842 20:45736305-45736327 TCCCGCTCTGGGGCCGCAGGTGG - Intergenic
1174162821 20:48564056-48564078 TCCCATACTGGGGCCGCAGGTGG + Intergenic
1174486609 20:50865407-50865429 TCACACACAGGGACAGCAGGTGG - Intronic
1175210143 20:57348811-57348833 TCCCGCACCGGGGCTGCAGGTGG - Intergenic
1175254222 20:57629202-57629224 TCCTGCCCCGGGGCTGCAGGTGG - Intergenic
1175581582 20:60103962-60103984 TCACTCACAGATGCTGCAGGTGG + Intergenic
1176144786 20:63560745-63560767 GGCCCCCCAGGGGCTGCAGGTGG + Intronic
1176150632 20:63589031-63589053 GCCAGCCCAGGGGCTGCATGGGG + Exonic
1176161963 20:63652833-63652855 TGCAGCACAGGGGCTGGAGGGGG - Intronic
1176189445 20:63800946-63800968 TCCGGCACTGGGGCTGCAGGTGG - Intronic
1176344765 21:5733455-5733477 TCCCGCACCAGGGCCGCAGGTGG + Intergenic
1176351579 21:5854039-5854061 TCCCGCACCAGGGCCGCAGGTGG + Intergenic
1176411608 21:6452165-6452187 GGCCGCGCAGGAGCTGCAGGAGG - Intergenic
1176500062 21:7591000-7591022 TCCCGCACCAGGGCCGCAGGTGG - Intergenic
1176539086 21:8131525-8131547 TCCCGCACCAGGGCCGCAGGTGG + Intergenic
1176558037 21:8314570-8314592 TCCCGCACCAGGGCCGCAGGTGG + Intergenic
1176663291 21:9660415-9660437 TCCTGCACCAGGGCCGCAGGTGG - Intergenic
1176671110 21:9735950-9735972 TCCCGCACTGGGGCCGCAGGTGG - Intergenic
1176872179 21:14092912-14092934 TCTCGCACAGGGGCCACAGGTGG + Intergenic
1176966544 21:15218522-15218544 TCCCGCACCGGGACTGCAGGTGG + Intergenic
1177497004 21:21902838-21902860 TCCCACACGGGGGCTGCAGGTGG - Intergenic
1177549173 21:22598208-22598230 TCCTGCGCTGGGGCCGCAGGCGG - Intergenic
1177565759 21:22818805-22818827 TCCCACACCGGGGCTGCAGGTGG + Intergenic
1177637689 21:23807429-23807451 TCCCACACTGGGGCTGCAGGTGG - Intergenic
1178074246 21:29000553-29000575 TCCCGTACCCGGGTTGCAGGTGG - Intergenic
1178082167 21:29077142-29077164 TCACGCACTAGGGCTACAGGTGG + Intergenic
1178327064 21:31654599-31654621 TCCCGCACCTGGGCTGCAGGTGG - Intergenic
1178398816 21:32265745-32265767 TCCCGCACCGGGGCTGCAGGTGG - Intergenic
1178585575 21:33868264-33868286 TCCCACACCGGGGCTGCAGCTGG + Intronic
1178983282 21:37283132-37283154 TCCCACACCGGGGCTGCAGCTGG + Intergenic
1179544092 21:42102943-42102965 TCCCGCAGAGGTGATGCAGAGGG + Exonic
1179614523 21:42573162-42573184 TCCTGCACGGGGGCATCAGGAGG + Intronic
1179687102 21:43060487-43060509 GGCCGCGCAGGAGCTGCAGGAGG - Exonic
1179785726 21:43728686-43728708 TCCCGCACGTGGGCAGGAGGAGG + Intronic
1179908769 21:44437268-44437290 CCCTGCCCAGGGGCTGCAGGGGG - Intronic
1179984821 21:44914361-44914383 CCCTGCACAGGGGAAGCAGGGGG + Intronic
1180189184 21:46154551-46154573 TCCCCACAAGGGGCTGCAGGTGG + Intronic
1180740970 22:18053316-18053338 TCCCGCACAGGGGCTGCAGGTGG + Intergenic
1180755161 22:18155901-18155923 TCCCACACCTGGGCCGCAGGTGG - Intronic
1180833383 22:18917804-18917826 ACATGCACAGCGGCTGCAGGAGG + Intronic
1180994014 22:19955550-19955572 TCCCCCACGGGGGCTGCAGAGGG - Intronic
1181066443 22:20308451-20308473 ACATGCACAGCGGCTGCAGGAGG - Intergenic
1181077602 22:20392357-20392379 TCCCGCACCGGGGCCGCAGGTGG + Intergenic
1181450471 22:23016999-23017021 TCCCGCGCCGGGGCTGCAGGTGG + Intergenic
1181475348 22:23164649-23164671 TGCCGCACCTTGGCTGCAGGGGG - Intergenic
1181530197 22:23513011-23513033 TGCAGCACAGGGGCAGCTGGAGG - Intergenic
1183062532 22:35345059-35345081 TCCCACACAGGGGCAGGAGTTGG - Intronic
1183422048 22:37717787-37717809 TCTCGTTCTGGGGCTGCAGGTGG + Intronic
1183486233 22:38089065-38089087 CCCCGCCCCGGGGCGGCAGGAGG - Intronic
1183508600 22:38222515-38222537 TCCCACCCAGGGGGTGCCGGTGG + Intronic
1183655389 22:39181529-39181551 TCCATCACAGTGGCAGCAGGAGG + Intergenic
1183685309 22:39358013-39358035 TCCCGCACCGGGGCTGCAGGTGG - Intronic
1183721238 22:39562760-39562782 TGCCCCACAGGTGCTGCAGTAGG + Intergenic
1183744509 22:39685261-39685283 TCCTGGGGAGGGGCTGCAGGTGG + Intronic
1183830762 22:40417412-40417434 TCCCAAAGAGGGGCTGCAGTGGG + Exonic
1183990426 22:41593932-41593954 TCTTGTACCGGGGCTGCAGGTGG - Intergenic
1184511191 22:44934245-44934267 TCCAGGACAGGGGAAGCAGGTGG - Intronic
1184584327 22:45437142-45437164 TTCCGCACCGGGGCTGCAGGTGG - Intergenic
1184770329 22:46593438-46593460 TGCCGCACAGGGAGGGCAGGTGG + Intronic
1184906175 22:47488253-47488275 TTCCGCACCGGGGCTGCAGGTGG + Intergenic
1185229045 22:49670153-49670175 TCCTGCACCGAGGCTGCAGGTGG + Intergenic
1203244036 22_KI270733v1_random:47880-47902 TCCCGCACCAGGGCCGCAGGTGG + Intergenic
1203283468 22_KI270734v1_random:143108-143130 ACATGCACAGCGGCTGCAGGAGG + Intergenic
949259052 3:2084041-2084063 TCCCGCACCGGGGCTGCAGGTGG - Intergenic
949292829 3:2485326-2485348 TCCTGCACTGGGGCCACAGGCGG - Intronic
949894962 3:8761987-8762009 TCCCTCCCAGGGGCTGAAGCCGG - Intronic
949984217 3:9526846-9526868 TCCCTCCCAGAGTCTGCAGGGGG + Intronic
950172921 3:10851879-10851901 TTTCTCAGAGGGGCTGCAGGAGG + Intronic
950189796 3:10968721-10968743 TGCAGCCCAGGGGCTGGAGGAGG - Intergenic
950203671 3:11061786-11061808 TCCCGCACAGGGGCTGCAGGTGG - Intergenic
950207956 3:11094413-11094435 TCCCACACAGGGGCCGCAGGTGG - Intergenic
950256586 3:11511543-11511565 TCCTGCACTGGGGCTGCAGGTGG + Intronic
950256892 3:11513192-11513214 TCCCGCACCGGGGCTGCAGGTGG + Intronic
950418622 3:12883263-12883285 TCCCGCACCGGGGCCACAGGTGG - Intergenic
950470232 3:13180130-13180152 ATCCGCACTGGGGCGGCAGGTGG - Intergenic
950513296 3:13447143-13447165 TCCCGCACTGGGGCTGCAGGTGG + Intergenic
950600312 3:14029442-14029464 TCCTGCACCGGGGCTGCAGGTGG + Intronic
950632710 3:14293585-14293607 TCCCGCACGGGGGCCGCAGGTGG - Intergenic
950929467 3:16774130-16774152 TGCCGCACTGGGGCTGCAGGTGG - Intergenic
951024781 3:17817619-17817641 TCCTGCACAGGGGCCGCAGGTGG + Intronic
951146520 3:19234231-19234253 TCCCGCACCGGGGCTGCAGGTGG + Intronic
951185036 3:19702941-19702963 TCCTGCACCAGGGCCGCAGGCGG - Intergenic
951332885 3:21387198-21387220 TGCCACACCGGGGCTGCAGGTGG + Intergenic
952058017 3:29473451-29473473 TCCCGCACGGAGGCCGCAGGTGG + Intronic
952275322 3:31870529-31870551 TCCCGCACCGGGGCTGCAGGTGG - Intronic
952355451 3:32579128-32579150 TCCCCCACTGGGGCCGCAGGTGG - Intergenic
952360544 3:32626048-32626070 TCCCTCACAGGGGCGGCAGGTGG - Intergenic
952398302 3:32940096-32940118 TCCCGCACTGGGGCTGCAGGTGG - Intergenic
952453766 3:33453870-33453892 TCCTGCACTGGGGCCGCAGGTGG - Intergenic
952593714 3:34988791-34988813 TCCCCCACTGGGGCTGCAGGTGG - Intergenic
952713385 3:36453716-36453738 TCCCGCACCGGGGCTGCAGGTGG - Intronic
952730722 3:36634321-36634343 TCCCGCACCGGGGCTGCAGATGG - Intergenic
952795322 3:37233432-37233454 TCCCGCACTGGGGCTGCAGGTGG - Intergenic
953002962 3:38951565-38951587 TCCCGCACCGGGGCCGCAGGTGG - Intergenic
953089903 3:39713729-39713751 TCCCGCACCGGGGCTGCAGGTGG - Intergenic
953124431 3:40077855-40077877 TCCCGCACCGGGGCTGCAGGTGG + Intronic
953307531 3:41844115-41844137 TCCCCCACCGGGGCCGCAGGTGG + Intronic
953522424 3:43656373-43656395 TCCCGCACAGGGGCTGCAGGTGG + Intronic
953673997 3:44986063-44986085 TCCTGCACTGGGGCCGCAGGTGG + Intronic
953714691 3:45307101-45307123 TCCCACACTGGGGCCACAGGTGG - Intergenic
953930833 3:47004939-47004961 ACCCGAGCAGGGGCTGCATGAGG - Intronic
954041072 3:47887622-47887644 TCTCGCACTGGGGCTGCAGGTGG - Intronic
954089259 3:48271887-48271909 TCCCGCACTGGGGCTGTGGGTGG + Intronic
954226132 3:49182611-49182633 TCCCGCACTGGGGCTGCAGGTGG + Intronic
954230513 3:49213484-49213506 TCCTGCACTGGGGCCGCAGGCGG + Intronic
954301761 3:49704080-49704102 TCAGGGAGAGGGGCTGCAGGAGG + Intronic
954620210 3:51990986-51991008 TCCCGCACCGGGGCTGCAGGTGG - Intergenic
954629693 3:52041118-52041140 TCCTGCACAGGGGCTGAGGGAGG - Intergenic
954800348 3:53183592-53183614 CCCCGCCCCTGGGCTGCAGGAGG + Intronic
955183428 3:56692294-56692316 TCCCGCACTGGGGCTGCAGGTGG - Intergenic
955210358 3:56934879-56934901 TCCCGCAGCGGGGCTGCAGGTGG - Intronic
955266387 3:57449292-57449314 TCCCACACCCGGGCTGCAGGTGG + Intronic
955405562 3:58623594-58623616 GCCCCGACAGGGGCTCCAGGTGG + Intronic
955449551 3:59051271-59051293 TCCCGCACTGGGGCCGCAGGTGG - Intergenic
956183866 3:66544591-66544613 TCACGCACCAGGGCTGCAGGTGG + Intergenic
956195812 3:66651941-66651963 TCCTGCACCGGGGCTGCAGGTGG - Intergenic
956392130 3:68785259-68785281 TCTCGCACTGGGGCTGCAGGTGG + Intronic
956481526 3:69677859-69677881 TCCCGCACCGGGGCTGCAGGTGG - Intergenic
956563699 3:70612227-70612249 TCTTGCACCAGGGCTGCAGGTGG - Intergenic
956632671 3:71331511-71331533 TCCCGCACCGGGGCCGCAGGTGG - Intronic
956855333 3:73269606-73269628 TCCCGCACCGGGGCTGCAGGTGG - Intergenic
957002199 3:74899922-74899944 TCCTGCATGGGGGCTGCAGGTGG + Intergenic
957009112 3:74985072-74985094 TCCCACACCGGGGCTGCAGGTGG + Intergenic
957056097 3:75444381-75444403 TCCCACACGGGGGCCACAGGTGG + Intergenic
957074152 3:75588168-75588190 TCCCACACAGGAGCCACAGGTGG - Intergenic
957277465 3:78108527-78108549 CCCCGGCCAGCGGCTGCAGGGGG + Intergenic
957277541 3:78108802-78108824 TCCCGCTCGGGGGCTGCAGGTGG - Intergenic
957362156 3:79173736-79173758 TCCCGCACTGGGGCCACAGGTGG - Intronic
957419589 3:79951317-79951339 TCCCGCATGGGGGCTGCAGGTGG + Intergenic
957446190 3:80314862-80314884 TCCCACACTGGGGCTGCAGGTGG - Intergenic
957560092 3:81811955-81811977 TCCCGCACCGGGGCTGCAGGTGG + Intergenic
957631011 3:82715744-82715766 TCCCGCATGGGGGCTGCAGGTGG - Intergenic
957804830 3:85133807-85133829 TCCCTCACCGGGGCTGCAGGTGG + Intronic
957829938 3:85504622-85504644 TACCTCACCGGGGCTGCAGGTGG + Intronic
957919607 3:86731457-86731479 TCCCGCACCAGGGCTGCAGGTGG + Intergenic
957995179 3:87679512-87679534 TCCCACACGCGGGCTGCAGGTGG - Intergenic
958022713 3:88016102-88016124 TCCCCCACCGGGGCTGCAGGTGG - Intergenic
958419944 3:93917998-93918020 TCCTGCACTGGGGCTGCAGGTGG - Intronic
958810691 3:98857919-98857941 TCCCGCACCGGGGCTGCAGGTGG + Intronic
959422808 3:106149047-106149069 TCTCGCACAGGGGCTGCAGGTGG - Intergenic
959991291 3:112635082-112635104 GCCTTCACAGGAGCTGCAGGTGG - Intronic
960149726 3:114238236-114238258 TCCCGCACCGGGGCTGCAGGTGG + Intergenic
960199336 3:114812643-114812665 TCCCGCACCCGGGCTGCAGGTGG + Intronic
960669277 3:120140662-120140684 TCCTGCACGGGGGCCGCAGGCGG - Intergenic
960685559 3:120290083-120290105 TCCCACACTGGGGCCACAGGTGG - Intergenic
960761594 3:121078478-121078500 TCCTGCACCAGGGCCGCAGGTGG + Intronic
960868516 3:122227161-122227183 TCCCGCACCGGGACCACAGGTGG + Intronic
960949387 3:122989272-122989294 AGCCGCACAGAGGCTGCTGGTGG + Intronic
961279940 3:125758572-125758594 TCCCGCACAGGAGCTGCAGGTGG + Intergenic
961298293 3:125904306-125904328 TCCCGCACTGGGGCCGCAAGTGG - Intergenic
961442802 3:126962748-126962770 TCCCGCACAGAGCCTGGAAGAGG - Intergenic
961460535 3:127047091-127047113 TCCCGCACCGGGGCTGCAGGTGG - Intergenic
961464981 3:127076231-127076253 TCCCACACCGGGGCCGCAGGTGG + Intergenic
961688881 3:128653812-128653834 TCCTGCACCCGGGCGGCAGGGGG - Intronic
961788299 3:129360508-129360530 TCCCGCACACTCACTGCAGGAGG - Intergenic
961874455 3:130011007-130011029 TCCCACACAGGAGCCGCAGGTGG - Intergenic
961932250 3:130547011-130547033 TCCTGCATGGGGGCAGCAGGTGG + Intergenic
962234444 3:133695135-133695157 ACCCTCAGAGGGGCTGCATGGGG + Intergenic
962283677 3:134070207-134070229 TCCCACACCGGGGCTGCAGGTGG + Intronic
962389058 3:134956543-134956565 TCATGCACAGGAGGTGCAGGTGG + Intronic
962398681 3:135039373-135039395 TCCCGCACTGGGGCTGCAGGTGG + Intronic
962591000 3:136889947-136889969 TCCCGCACAGGGGTTGCAGGTGG + Intronic
962600426 3:136987534-136987556 TCCCGCACCAGGGCTGCCGGTGG + Intronic
962758325 3:138485063-138485085 TCCCACACCAGGGCTGCAGGTGG - Intergenic
963397288 3:144750222-144750244 TCCCGCACCAGGGCTGCAGGTGG - Intergenic
963397967 3:144757308-144757330 TCCCGAGCCAGGGCTGCAGGCGG - Intergenic
963440482 3:145333791-145333813 TCCCGCACCGGGGCTGCAGGTGG - Intergenic
963509083 3:146225378-146225400 TCCCGCAGCAGGGCTGCAGGTGG + Intronic
963589919 3:147245551-147245573 TCCTGCACCGGGGCTGCAGGTGG + Intergenic
963651755 3:147989323-147989345 TCCCGCACCAGGACTGCAGGTGG + Intergenic
963673438 3:148280512-148280534 TCCCGCACTGGGGCCGCAGGTGG + Intergenic
963742849 3:149097667-149097689 TCCTGCACCTGGGCTGCAGGTGG + Intergenic
963744227 3:149109770-149109792 TCCTGCACCCGGGCTGCAGGTGG - Intergenic
963760664 3:149284400-149284422 TCCCGCACCAGGGCCGCAGGTGG - Intergenic
963862251 3:150323384-150323406 TCCAGCACCGGGGTTGCAGGTGG - Intergenic
964014458 3:151928570-151928592 TCCCGCACCGGAGCTGCAGGTGG - Intergenic
964032398 3:152152833-152152855 TCCCTTACCGGGGCTGCAGGTGG - Intergenic
964037608 3:152217715-152217737 TCACGCACCAGGGCCGCAGGTGG - Intergenic
964117901 3:153155695-153155717 TCGCGCAATGGGGCTGCAGGTGG + Intergenic
964139151 3:153378282-153378304 TCCCGCACTGGGGCTGCAGGTGG + Intergenic
964375118 3:156041680-156041702 TCTCCCACCGGGGCCGCAGGTGG - Intronic
964378587 3:156073530-156073552 TCCCGCAACGGGGCCACAGGTGG - Intronic
964381166 3:156099838-156099860 TCCCTCACCGGGGCCGCAGGTGG - Intronic
964444075 3:156740991-156741013 TCCCGCACAGGGGATGCAGGTGG - Intergenic
964751931 3:160060942-160060964 CCCTGCACAGGGGCTACAGGTGG - Intergenic
964802820 3:160573935-160573957 TCCCGCACCCTGGCTGCAGGTGG + Intergenic
964974247 3:162600117-162600139 TCTCGCACTGGGGTTGCAGGTGG - Intergenic
964993440 3:162844562-162844584 TCCTGCACTGGGGCCGCAGGTGG + Intergenic
965040370 3:163499438-163499460 TCTCACACTGGGGCTGCAGGTGG - Intergenic
965109346 3:164401835-164401857 TCCCGCACCGGGGCTGCAGGTGG + Intergenic
965200273 3:165649263-165649285 TCCCGCACTGCGGCTGCAGGTGG + Intergenic
965220139 3:165918392-165918414 TCCTGCACCGGTGCTGCAGGTGG + Intergenic
965220826 3:165924283-165924305 TCCCGCACCTGGGCGGCAGGTGG + Intergenic
965245167 3:166258414-166258436 TCCCACACCAGGGCTGCAGATGG + Intergenic
965288117 3:166843225-166843247 TCCCACACCAGGGCTGCAGGTGG - Intergenic
965298200 3:166976247-166976269 TCCCGCACCGGGGCTGCAGGTGG - Intergenic
965446537 3:168780522-168780544 TCCAGCACCAGGGCTGCAGGTGG - Intergenic
965753157 3:171998817-171998839 TCCCACACTGGGGCTGCAGGTGG + Intergenic
965837446 3:172867196-172867218 TCCCACACCAGGGCTGCAGGTGG - Intergenic
965943408 3:174211918-174211940 TCCCGCACTGGGGCTGCAGGTGG + Intronic
966076131 3:175937786-175937808 TCGTGCACTGGGGCTGCAGGTGG - Intergenic
966096712 3:176213362-176213384 TCCCGCACTGGGGCTGCAGGTGG + Intergenic
966108141 3:176362172-176362194 TCCTGCACTGGGGTCGCAGGCGG + Intergenic
966190940 3:177271674-177271696 TCCTGCACCGGGGCTGCAGGTGG + Intergenic
966246005 3:177808896-177808918 TCTTGCACCGGGGCTGCAGGTGG + Intergenic
966372357 3:179263000-179263022 TCCCGCACCGGGGCCACAGGTGG + Intronic
966548904 3:181182965-181182987 TCCCTCACAGGGGCTGCAGGTGG + Intergenic
966725076 3:183101314-183101336 TCCCGCACCGGGGCTGCAGGTGG - Intronic
966725357 3:183103693-183103715 TCCGGCACTGGGGCTGCAGGTGG + Intronic
967448576 3:189596538-189596560 TCTCCCACCGGGGCTGCAGATGG - Intergenic
967499078 3:190176995-190177017 TCCTGCACCGGGGCTGCAGATGG + Intergenic
967594843 3:191316959-191316981 TCCCACGCCGGGGCTGCCGGCGG + Intronic
967718432 3:192789446-192789468 TACCGCACCAGGCCTGCAGGTGG - Intergenic
968077319 3:195823598-195823620 GACGGCACAGGGGCTGGAGGTGG - Intergenic
968181520 3:196598984-196599006 TCCCGCACTGGGGCTGCAGGTGG + Intergenic
968412739 4:403946-403968 TCCCGCGCCGGGGCTGCAGGTGG + Intergenic
968445968 4:652195-652217 TGGTGCTCAGGGGCTGCAGGGGG + Intronic
968469742 4:773942-773964 TCCTGCGCTGGGGCTGCAGGTGG - Intergenic
968572152 4:1347427-1347449 TCTCGCACAGCGGCTGCACCGGG - Exonic
968742437 4:2338040-2338062 TCCCGCACATGGGCAGCACTGGG - Intronic
968998905 4:3964662-3964684 TCCCTCACGGGGGCCGCAGGTGG + Intergenic
969017771 4:4115768-4115790 TCCCACACAGGAGCCGCAGGTGG - Intergenic
969303076 4:6308980-6309002 TCCCCCAACCGGGCTGCAGGTGG + Intergenic
969362428 4:6673137-6673159 TCCCACACCAGGGCTGCAGGTGG - Intergenic
969440813 4:7215543-7215565 TCCCGCACCGGGGCTGCAGGTGG - Intronic
969654905 4:8491356-8491378 TCCCGCACCAGGGCAGCAGGTGG + Intronic
969755090 4:9143971-9143993 TCCCACACGGGGGCCGCAGGTGG - Intergenic
969795419 4:9524407-9524429 TCCCGCACAGGAGCTGCAGGTGG + Intergenic
969814997 4:9680254-9680276 TCCCACATGGGGGCCGCAGGTGG - Intergenic
970007292 4:11424093-11424115 TCCAGCACAGGGGCTGCAGGCGG - Intronic
970182661 4:13415797-13415819 TCCTGCACTGGGGCTGCAGGTGG - Intronic
970272182 4:14359027-14359049 TCCTGCAATGGGGCCGCAGGTGG - Intergenic
970391289 4:15615328-15615350 TCCCACACCGGGGTTGCATGTGG - Intronic
970574504 4:17414251-17414273 TCCCGCACAGGGGCCGCCAAGGG + Intergenic
970615684 4:17766755-17766777 TCCCGCACCGGGGCAGCAGGCGG + Intronic
970649250 4:18159216-18159238 TCCCGCACCGGGGCTGCAGGTGG + Intergenic
970673091 4:18418283-18418305 TCCCGCACCGGGGCTGCAGGTGG + Intergenic
970803605 4:20004429-20004451 TCCCGCACCGGGGCTGCAGGTGG - Intergenic
970817811 4:20178957-20178979 TCCCGTACTAGGGCTGCAGGTGG + Intergenic
971280459 4:25239188-25239210 TCCCACACTGGGGCCACAGGTGG + Intronic
971281609 4:25246570-25246592 TCCCACACTGGGGCCACAGGTGG + Intronic
971377037 4:26063916-26063938 TCCCGCACTGGGGCTGCAGGTGG + Intergenic
971552967 4:27978281-27978303 TCCCACACTGGGGCTGCAGGTGG + Intergenic
971563632 4:28113190-28113212 TCCCACACCTGGGCTGCAGGTGG - Intergenic
971618851 4:28828421-28828443 TCCTGCACTGGGGCCACAGGTGG - Intergenic
971639895 4:29117768-29117790 TCCCGCACTGGGGCTGCAGGTGG - Intergenic
971792277 4:31184915-31184937 TCCCGCTCCGGGGCTGCAGGTGG + Intergenic
971812024 4:31439066-31439088 ACCCGCACGGGGGCTGCAGGTGG - Intergenic
971905118 4:32716171-32716193 TCCTGCACCGGGGCTGCAGGTGG + Intergenic
972022714 4:34335586-34335608 TCCCACACCAGGGCTGCAGGTGG + Intergenic
972034728 4:34506566-34506588 TCCGGCACGGGGGCTTCAGGTGG + Intergenic
972173452 4:36375385-36375407 TCCCACACTGGGGCCGCAGGCGG - Intergenic
972360872 4:38324865-38324887 TCCTGCACCAGGGCCGCAGGCGG + Intergenic
972392630 4:38627317-38627339 TCCCGCACTGCCCCTGCAGGTGG - Intergenic
972505716 4:39718460-39718482 TCTCGCACCGGGGCCACAGGTGG + Intronic
972900199 4:43672772-43672794 TCCCGCACCAGGGCTGCAGGTGG - Intergenic
973037176 4:45420565-45420587 TCCCGCACAGGTGCTGCAGGTGG - Intergenic
973041733 4:45477297-45477319 TCCTGCACCGGGGCCGCAGGTGG + Intergenic
973045459 4:45530867-45530889 TCCCGCACCAGGGCTGCGGGCGG - Intergenic
973144194 4:46804776-46804798 TCCCCTACCGGGGCCGCAGGTGG + Intronic
973146397 4:46831462-46831484 TCCCGCACTGGGGCCACAGGTGG - Intronic
973190241 4:47377989-47378011 TCTCGCACTGGGGCTGCAGGTGG + Intronic
973308148 4:48675755-48675777 TCCTGCACAGGGGCTGCAGGTGG - Intronic
973322835 4:48827796-48827818 TCCCATGCCGGGGCTGCAGGTGG - Intronic
973587688 4:52409691-52409713 TCCCGCACCAGGGCTGCAGGTGG + Intergenic
973817658 4:54632950-54632972 TCCCGCACTGGGGCTGCAGGTGG - Intergenic
973854177 4:54993884-54993906 TCCTGCACCGGGGCCACAGGTGG - Intergenic
974089818 4:57300117-57300139 TCCTGCACCAGGGCTGCTGGTGG + Intergenic
974128889 4:57729718-57729740 TCCCACACCTGGGCCGCAGGTGG + Intergenic
974147492 4:57965839-57965861 TCCCGCACTGGGGCTGCAGGTGG - Intergenic
974186861 4:58457343-58457365 TCCCCCACTGGGGCTGTGGGCGG - Intergenic
974484712 4:62491843-62491865 TCCTGCACCTGGGCTGCAGGTGG + Intergenic
974590514 4:63942828-63942850 TCCCGCACCTGGGCTGCAGATGG + Intergenic
974641673 4:64640419-64640441 TCCCGCATGGGGGCTGCAGGTGG + Intergenic
974781667 4:66561438-66561460 TCCCACACCAGGGCTGTAGGTGG + Intergenic
974804461 4:66860583-66860605 TCCCGCACCGGGGCTGCAGGTGG - Intergenic
974827832 4:67152294-67152316 TCCCGCACAGGGGCTGCAGGTGG - Intergenic
974892224 4:67896511-67896533 TCCCCCATTGGGGTTGCAGGTGG + Intergenic
974992800 4:69115186-69115208 TCCCACACTGGGGTCGCAGGTGG + Intronic
975055472 4:69924305-69924327 TCCCACACTGGGGCTGCAGGTGG - Intergenic
975298882 4:72766270-72766292 TCCCGCAGGGGGTCTGCAGGTGG - Intergenic
975595113 4:76043240-76043262 TCCCGCACCAGGGCTGCAGGTGG + Intronic
975596291 4:76050602-76050624 TCCCGCACCAGGGCTGCAGGTGG + Intronic
975755940 4:77571077-77571099 TCCCACACCGGGGCTGCAGATGG - Intronic
975994999 4:80303208-80303230 TCCCGCACTGGGGCAGCAGGTGG - Intronic
976102563 4:81580865-81580887 TCCCACACCGGGGCTGCAGGTGG - Intronic
976167714 4:82272657-82272679 TCCAGCAGATGGGCAGCAGGGGG + Intergenic
976268545 4:83207633-83207655 TCCTGCTGAGGGGCGGCAGGCGG - Intergenic
976406453 4:84665113-84665135 TCCTGCACGGGGGCTGCAGGTGG - Intergenic
976520558 4:86021553-86021575 TCCCGTACCAGGGCTGCAGGTGG + Intronic
976646798 4:87395892-87395914 TCCCGCACAGGGGCTGCAGGTGG + Intergenic
976736232 4:88313149-88313171 TCCCGCACTGGGGCCGCAGGTGG + Intergenic
976980223 4:91217916-91217938 TCCCGCACCGGGGCTGCAGGTGG + Intronic
977206599 4:94170258-94170280 TCCCCTACTGGGGCCGCAGGTGG - Intergenic
977416729 4:96742933-96742955 TCCCGCACTGGAGCCGCAGGCGG - Intergenic
977470626 4:97438028-97438050 TCCCGCACCGGGGCCACAGGTGG + Intronic
977507764 4:97923435-97923457 TCCAGCACTGGGGCCACAGGTGG - Intronic
977606846 4:98993427-98993449 TCCCGCACTGGGGCCGCAGGTGG + Intergenic
977717276 4:100196466-100196488 TCCCGAACCAGGGCTGCAGGTGG + Intergenic
977750890 4:100608711-100608733 TCCCGCACCGGGGCTGCAGGTGG + Intronic
977883669 4:102234753-102234775 TCCCATGCAGGGGCAGCAGGTGG - Intergenic
977906550 4:102483543-102483565 TCCTGCACTGGGGCTGCAGGTGG - Intergenic
978080325 4:104582395-104582417 TCCCGCACCGGGGCTGCAGATGG - Intergenic
978207123 4:106092345-106092367 TCCCACACTGGGGCCGCAGGTGG + Intronic
978241812 4:106525290-106525312 TCCCTCACTGGGGCTGCAGGTGG + Intergenic
978285657 4:107073608-107073630 TCCCTCACCAGGGATGCAGGTGG - Intronic
978463550 4:108984337-108984359 TCCCGCACAGGGGCTGCAGGTGG + Intronic
978917907 4:114148526-114148548 TCCTGCACTGGGGCCGCAGGTGG + Intergenic
978997971 4:115179377-115179399 TCTCACACTGGGGCTGCAGGTGG + Intergenic
979290743 4:118976996-118977018 TCCCGCACCGGGGCTGCAGCTGG + Intronic
979308395 4:119174200-119174222 TCCCGCACCAGGGCTGCAGGTGG - Intronic
979424680 4:120550683-120550705 TCCCGCACTGGGGTTGCAGGTGG + Intergenic
979434607 4:120673707-120673729 TCCCCCACAGTGGCTGCAGCAGG + Intergenic
979609091 4:122670629-122670651 TCCGGCACTGGGGCCACAGGTGG - Intergenic
979688667 4:123538331-123538353 TCCCGCACCTGGGCTGCAGGTGG - Intergenic
979822621 4:125192316-125192338 TCCCTCACAGGGGCTGCAGGTGG - Intergenic
979825632 4:125229528-125229550 TCCCGCACTGGGGCTGCAGGTGG + Intergenic
979857441 4:125651709-125651731 TCCCACACCGGGGGTGCAGGTGG + Intergenic
979899632 4:126201237-126201259 TCCCGCACCGGGGCTGCAGGTGG + Intergenic
979991538 4:127380355-127380377 TCCCGCACCAGGGCTGCAGGTGG - Intergenic
980043305 4:127964183-127964205 TCCCGCACCGGGGCTGCAGGTGG + Intronic
980051857 4:128047505-128047527 TCCCGCAGCGGGGCTGCAGGTGG + Intergenic
980228054 4:130013194-130013216 TCCGGCAGCGGGGCTGCAGGTGG - Intergenic
980230184 4:130038492-130038514 TCCGGCAGTGGGGCTGCAGGTGG + Intergenic
980470154 4:133240353-133240375 TCCCACACCGGGGCTGCAGGTGG + Intergenic
980628666 4:135407033-135407055 TCCCGCACCGGGGCTGCAGGTGG - Intergenic
980739332 4:136929409-136929431 TCCCACACCGGGGCCGCAGGTGG - Intergenic
980799835 4:137734150-137734172 TCCCGCACTGGGGCCGCAGGTGG - Intergenic
980815630 4:137942485-137942507 TCCCGCACCGGGGCTGCAGGTGG - Intergenic
981146649 4:141332964-141332986 TCCCGCAGCGGGGCTGCAGATGG + Intergenic
981176517 4:141689804-141689826 TCCCACACTGGGGCTGCAGGTGG + Intronic
981275888 4:142897912-142897934 TCCCACACCGGGGTTGCAGGTGG - Intergenic
982408300 4:155044717-155044739 TCCCACACCAGGGCTGCAGGTGG - Intergenic
982647736 4:158044541-158044563 TCCCGCACCCGGGCAGCCGGTGG - Intergenic
982692839 4:158567314-158567336 TCGCTCACAGGGGCTGCAGGTGG - Intronic
982728262 4:158928116-158928138 TCCCACACCTGTGCTGCAGGTGG - Intronic
982814507 4:159868978-159869000 TCCCGCACCGGGGCTGCAGGTGG + Intergenic
983026169 4:162739955-162739977 TCCCACACCAGGGCTGCAGGTGG - Intergenic
983060406 4:163153260-163153282 CACTGCACCGGGGCTGCAGGTGG - Intronic
983064015 4:163189660-163189682 TCTCGCACCCGGGCTGCAGGTGG + Intergenic
983135011 4:164068768-164068790 TCCCTCACCAGGGCCGCAGGTGG - Intronic
983230589 4:165125886-165125908 TCCCGCACGGCGGCTGCAGGTGG + Intronic
983552984 4:169035782-169035804 TCCCACATCCGGGCTGCAGGTGG + Intergenic
983752919 4:171298695-171298717 TCCCGCACCGGGGTTGCAGGTGG - Intergenic
984192758 4:176625110-176625132 TCCCGCACCAGGGATGCAGGTGG + Intergenic
984238744 4:177193142-177193164 TCCCGCACCTGGGCTGCAGGTGG + Intergenic
984241769 4:177227511-177227533 TCCTGCACCGGGGCTGCAGGTGG + Intergenic
984265736 4:177496006-177496028 TCCCGCACAGGGGCTGCAGGTGG - Intergenic
984275664 4:177607054-177607076 TCCCGCACCAGGGCCACAGGTGG + Intergenic
984662322 4:182386964-182386986 TCCCGCACAGGGGCTGCAGGTGG - Intronic
984728723 4:183045480-183045502 TCCTGCACTGGGGCTGCAGGTGG - Intergenic
984770638 4:183433559-183433581 TCCTGCACCGGGGCTGCAGGTGG - Intergenic
984776034 4:183482634-183482656 TCCCCCACCGGGGCTGCAGGTGG + Intergenic
984901820 4:184592281-184592303 TCCCGCACCAGGGCCGCAGGTGG - Intergenic
984918179 4:184741618-184741640 TCCCACACCAGGGCTGCAGGCGG - Intergenic
984948645 4:184990033-184990055 TCCTGCACCAGGGCTGCAGGTGG + Intergenic
985145497 4:186890529-186890551 TCTCACACCGGGGCCGCAGGTGG - Intergenic
985195041 4:187420568-187420590 TCCCACACTGGGGCTGCAGGTGG + Intergenic
985366474 4:189236720-189236742 TCCCGCACAAGGACTGCAGGTGG - Intergenic
985403530 4:189615152-189615174 TCCTGCACTGGGGAGGCAGGTGG + Intergenic
985403795 4:189616592-189616614 TCCCGCACAGGGGCTGCAGGTGG + Intergenic
985412035 4:189695635-189695657 TCCTGCACCAGGGCCGCAGGTGG + Intergenic
985701528 5:1376093-1376115 TCCCACACAGTGGCTGCTGGTGG + Intergenic
986121216 5:4837948-4837970 TCCCACACCGGGGCCGCAGGTGG - Intergenic
986626250 5:9725742-9725764 TCCCGCACTGGAGCTGCAGGTGG - Intergenic
986661829 5:10065918-10065940 TCCCGCACCCGGGCCGCAGGTGG - Intergenic
986698070 5:10375571-10375593 TCCCGCACCCGGGCTGCAGGTGG - Intronic
986963661 5:13244600-13244622 TCCCACGCTGGGGCTGCAGGCGG - Intergenic
987146177 5:14993750-14993772 TCCCACACCGGGGCTGCAGGTGG + Intergenic
987156688 5:15096461-15096483 TCCCGCACCAGGGCTGCAGGTGG + Intergenic
987283806 5:16436595-16436617 TCCCGCACCAGGGCCGCAGGTGG - Intergenic
987315365 5:16718366-16718388 TCCCGCACCAGGGCTGCAGGTGG - Intronic
987347369 5:16990927-16990949 TCCCGCACTGGGGCCGCAGGTGG + Intergenic
987383937 5:17311719-17311741 TCCTGCACCGGGGCTGCAGGTGG + Intergenic
987532707 5:19142716-19142738 TCCCGCACCGGGGCTGCAGGTGG + Intergenic
987877021 5:23691539-23691561 TCCCGCACTGGGGCTGCAGGTGG - Intergenic
987896366 5:23951711-23951733 TCCCTCACCGGGGCTGCAGGTGG - Exonic
987990177 5:25199968-25199990 TCCCACAGAGGGGCTGCAGGTGG + Intergenic
988073580 5:26324875-26324897 TCCCGCACCGGGGCTGCAGGTGG - Intergenic
988086914 5:26485226-26485248 TCCCGCATGGGGGCTGCAGGTGG + Intergenic
988132234 5:27120314-27120336 TCCCACACCGGGGCTGCAGGTGG - Intronic
988154981 5:27439396-27439418 TCCTGCACCGGGGCTGCAGGTGG + Intergenic
988177344 5:27743875-27743897 TCCCACACCAGGGCTGCAGGTGG - Intergenic
988279489 5:29127569-29127591 TTCCGCATTGGGGCTGCAGGTGG + Intergenic
988291693 5:29296438-29296460 TCCCCCACTGGGGCCGCAGGTGG + Intergenic
988369339 5:30346166-30346188 TCCCGCACAGGGGCTGCAAGTGG - Intergenic
988489073 5:31691959-31691981 TCCCACACCAGGGCTGCAGGTGG + Intronic
988684664 5:33515334-33515356 TCCCACACAGGGGCTGCAGGTGG + Intergenic
988883668 5:35532042-35532064 TCCTGCACTGGGGCTGCAGGTGG - Intergenic
988915825 5:35892813-35892835 TCCCGCACTGGGGTTGCAGGTGG + Intergenic
989003276 5:36782995-36783017 TCCCACACCGGGGCTGCAGGTGG - Intergenic
989346868 5:40439074-40439096 TCCCGCACCGGGGCTGCAGGTGG - Intergenic
989956922 5:50369852-50369874 TCCCACACCGGGGCTGCAGGTGG - Intergenic
989957999 5:50377245-50377267 TCCTGCACTGAGGCTGCAGGTGG - Intergenic
989965894 5:50465428-50465450 TCCTGCACCAGGGCTGCAGGTGG - Intergenic
990194618 5:53300831-53300853 TCCCTCACTGGGGCAGGAGGAGG - Intergenic
990419039 5:55613765-55613787 TCCTGCACGGGGGCCACAGGCGG - Intergenic
990461595 5:56035904-56035926 TCCCGCACCAGGGCTGCAGGTGG - Intergenic
990490138 5:56295739-56295761 TCCCTCACAGGGGCTGCAGGTGG - Intergenic
990880293 5:60530712-60530734 TCCCGCACGGGGGCCGCAGGTGG - Intergenic
991215019 5:64150485-64150507 TCTCGCACCAGGGCTGCAGGTGG - Intergenic
991330164 5:65485424-65485446 TCCCGCACCGGGGCTGCAGGTGG + Intergenic
992106360 5:73451691-73451713 CCCCGCGCAGGGGCTCCTGGAGG - Intergenic
992296809 5:75334100-75334122 TCCTGCACCAGGGCTGCAGGTGG - Intergenic
992947521 5:81824128-81824150 TCCCGCACCAGGGCTGCAGGTGG - Intergenic
993031947 5:82715104-82715126 TCCCGCACTGGGGCTGCAGGTGG - Intergenic
993320860 5:86466627-86466649 TCCCACACCGGGGCTGCAGGTGG + Intergenic
993328497 5:86569467-86569489 ATCCGCACGGGGGCTGCAGGTGG + Intergenic
993529114 5:89003570-89003592 TCCCGCACCGGGGTCGCAGGTGG + Intergenic
993678533 5:90847463-90847485 TCCCGCACCAGGGCTGCAGGTGG + Intronic
993803467 5:92374839-92374861 TTCCACACTGGGGCTGCAGGTGG + Intergenic
993822114 5:92631746-92631768 TCCCACACTGGGGCTGCAGGTGG - Intergenic
994096417 5:95851581-95851603 TCCCGCACCTGGGCTGCAGGTGG - Intergenic
994230036 5:97301563-97301585 TCCTGCACTGGGGCTGCAGGTGG - Intergenic
994251438 5:97541822-97541844 TCCTGCACCAGGGCCGCAGGTGG + Intergenic
994254721 5:97579940-97579962 TCCCGCACCGGGGCTGCAGGTGG + Intergenic
994507189 5:100657177-100657199 TCCTGCAGGGGGGCTGCAGGTGG - Intergenic
994509767 5:100688813-100688835 TCCCGCACGGGGGCTGCAGGTGG + Intergenic
994570372 5:101506443-101506465 TCCTGCACCAGGGCTGCGGGCGG - Intergenic
994647690 5:102491337-102491359 TCCCCTACCGGGGCCGCAGGTGG + Intronic
994701629 5:103141980-103142002 TCCCGCACCAGGGCTGCAGGTGG + Intronic
994769716 5:103966272-103966294 TCTCGCACTGGGGCTGCAGGTGG + Intergenic
994928877 5:106154672-106154694 TCCCGCACAGGGGCTGTAGGTGG - Intergenic
994935351 5:106246625-106246647 TCCCGCACCGGGGCTGCAGGTGG - Intergenic
995032381 5:107494610-107494632 TCCCCCAACGGGGCTGCAGATGG - Intronic
995326347 5:110893973-110893995 TCCCGCACGGGGGCTGCAGGTGG + Intergenic
995388259 5:111612097-111612119 TCCCGCACCAGGGCTGCAGGTGG + Intergenic
995568743 5:113457558-113457580 TCCTGCACCTGGGCTGCAGGTGG - Intronic
995596385 5:113753064-113753086 TCCTGCACCGGGGCTGCAGGTGG + Intergenic
995656578 5:114433095-114433117 TCCTGCACAGGGGCTGCAGGTGG - Intronic
995679797 5:114704234-114704256 TCCCGCACTGGGGCTGCAGGTGG + Intergenic
995700472 5:114929322-114929344 TCCCACACCGGGGCTGCAGGTGG - Intergenic
995920470 5:117305077-117305099 TCCCGCACCTGGGCTGCAGGTGG - Intergenic
995975903 5:118034240-118034262 TCCCACACTGGGACCGCAGGTGG - Intergenic
996107117 5:119517519-119517541 TCCCACACCAGGGCTGCAGGTGG - Intronic
996234294 5:121107591-121107613 TCCCGCAGCGGGGCTGCAGGTGG - Intergenic
996435772 5:123430969-123430991 TCCCGCACCGGGGCTGCAGGTGG - Intergenic
996478626 5:123949135-123949157 TCCCGCACTGGGGCCGCAGGTGG + Intergenic
996586058 5:125089073-125089095 TCCTGCACCAGGGCTGCTGGTGG - Intergenic
997352284 5:133239374-133239396 TCCTGCACCAGGTCTGCAGGTGG - Intronic
997760636 5:136444629-136444651 TCCCGCACCGGGGCTGCAGGTGG - Intergenic
998176378 5:139904459-139904481 TCGGGCACTGAGGCTGCAGGCGG - Intronic
999406257 5:151309607-151309629 TCCCACACCGGGGATGCAGGTGG - Intergenic
999838924 5:155403331-155403353 TCCCCCACAGCAGCTGCAGCAGG + Intergenic
999855209 5:155586698-155586720 TCCCGCACGGGGGCTGCAGGTGG + Intergenic
1000066108 5:157694253-157694275 TGCCACACTGGGGCTGCAGGTGG - Intergenic
1000084820 5:157879692-157879714 TCCCACACCGAGGCCGCAGGTGG - Intergenic
1000212426 5:159119545-159119567 TCCCGCACCAGGGCCACAGGTGG - Intergenic
1000329114 5:160193842-160193864 TCCCGCACCAGGGTTGCAGGTGG + Intronic
1000394636 5:160760842-160760864 TCCCCCACAGTGGCCGCAGTAGG + Intronic
1000432302 5:161166103-161166125 TCCCACACAGGGGTCGCAGGTGG + Intergenic
1000547685 5:162622259-162622281 TCCCGCACTGGGGCCACAGGTGG - Intergenic
1000609208 5:163356228-163356250 TCCTGCATGGGGGCTGCAGGTGG - Intergenic
1000891742 5:166810141-166810163 TCTCGCACAGGGGCTGCAGGTGG + Intergenic
1001569716 5:172722353-172722375 CCCAGCACAGAGCCTGCAGGAGG - Intergenic
1002004562 5:176221971-176221993 TCCCGCACCGGGGCTGCAGGTGG + Intergenic
1002221813 5:177688649-177688671 TCCCGCACTGGGGCTGCAGGTGG - Intergenic
1002455463 5:179343841-179343863 TCCCGAGCAGGGGCTCCACGCGG + Exonic
1002616525 5:180459589-180459611 TCTTGCACAGGGGCCGCAGGTGG - Intergenic
1002688865 5:181036882-181036904 GCCATCACAGGGGCTGCAGCAGG + Intergenic
1002789305 6:426146-426168 TCCCGCACCGGGGCTGCAGGCGG + Intergenic
1002793272 6:450383-450405 TCTCACACTGGGGCCGCAGGTGG - Intergenic
1002839396 6:893013-893035 TCCCGCAGATGGGTGGCAGGTGG - Intergenic
1002906953 6:1456916-1456938 TCCCCTACCGGGGCTGCAGGTGG + Intergenic
1003060797 6:2860555-2860577 CCCCACACTGGGGGTGCAGGTGG - Intergenic
1003070285 6:2940008-2940030 TCCTGTACTGGGGCTGCAGGTGG - Intergenic
1003170779 6:3720711-3720733 TCCCACACTGGGGCTGCAGGTGG + Intergenic
1003213810 6:4090505-4090527 TCCCATACCGGGGCCGCAGGTGG - Intronic
1003224395 6:4191233-4191255 TCTCGTACCAGGGCTGCAGGTGG + Intergenic
1003284779 6:4725275-4725297 TCCCGCACCGAGGGTGCAGGTGG + Intronic
1003489158 6:6606418-6606440 TCCTGCACCTGGGCGGCAGGTGG + Intronic
1003489972 6:6613223-6613245 TCCGGCACTAGGGCCGCAGGTGG + Intronic
1003506612 6:6745662-6745684 TCCCACACCGGGGCCGCAAGTGG + Intergenic
1003508768 6:6762426-6762448 TCTCGCACTGGGGCTGCAGGTGG + Intergenic
1003578100 6:7315590-7315612 ACCCGTACTGGGGCTGCAGGTGG - Intronic
1003578249 6:7316769-7316791 TCCCACACCGGGGCTGCAGGTGG + Intronic
1003581512 6:7344630-7344652 TCCGGCACCGGGGCTGCAGGTGG - Intronic
1003589669 6:7426152-7426174 TCCCGCACTGGGGCCGCAAGTGG - Intergenic
1003593779 6:7456734-7456756 TCCCGCACCCGGGCCGCAGGGGG - Intergenic
1003671612 6:8164748-8164770 TCTGGCACCGGGGCTGCAGGTGG - Intergenic
1003717776 6:8666383-8666405 TCCCACACCGGGGCTGCAGGTGG - Intergenic
1003736970 6:8887580-8887602 TCCCGCACCGGGGCTGCAGGTGG - Intergenic
1003748086 6:9024681-9024703 TCCCGCACGGGGGCTGCAGGTGG - Intergenic
1003749630 6:9041105-9041127 TTTCGCACTGGTGCTGCAGGTGG - Intergenic
1003770077 6:9290389-9290411 TTCCGCACAGGGGCTGCAGGTGG + Intergenic
1003824993 6:9942608-9942630 TCTCGCACCGGGGTGGCAGGTGG - Intronic
1003836140 6:10074656-10074678 TCCCGCACCAGAGCCGCAGGTGG + Intronic
1003845807 6:10172169-10172191 TCCCGCACCTGGGCTGCAGGTGG - Intronic
1003862866 6:10337826-10337848 TCCCGCACCGGGGCTGCAGGTGG - Intergenic
1003896950 6:10617005-10617027 TCCCGCACCAGGGCCGCAGGTGG + Intronic
1003901666 6:10660304-10660326 TCCCGCACTGGGGCCGCAGGTGG - Intergenic
1003908204 6:10721004-10721026 TCCCACACCAGGGCTGCAGGTGG - Intergenic
1003982394 6:11402527-11402549 TCCCAGACAGGGGTTGCAGCTGG + Intergenic
1004037044 6:11933496-11933518 TCCCGCACCGGGGCTGCAGGTGG - Intergenic
1004045294 6:12017877-12017899 TCCCGCACTGGGGCCACAGGTGG + Intronic
1004053078 6:12108335-12108357 TCCTGCACCAGGACTGCAGGTGG + Intronic
1004231128 6:13834368-13834390 TCACACACCGGGGCTGTAGGGGG + Intergenic
1004235476 6:13871880-13871902 TCTTGTACCGGGGCTGCAGGTGG + Intergenic
1004248514 6:14002803-14002825 TACCCCAGTGGGGCTGCAGGTGG - Intergenic
1004250377 6:14018411-14018433 TCTCGCACTGGGGCCGCAGGTGG - Intergenic
1004338149 6:14783549-14783571 TCCCACACCTGGGCCGCAGGTGG + Intergenic
1004486202 6:16069146-16069168 TGCCGCACAGGGGCTGCAGGTGG + Intergenic
1004501963 6:16217243-16217265 TCCTGCACTGGGGCTGCAGGTGG - Intergenic
1004503116 6:16226814-16226836 TCCCGCACTGGGGCTGCAGGTGG + Intergenic
1004511722 6:16288670-16288692 ATCCGCACTGGGGCTGCAGATGG - Intronic
1004665461 6:17745253-17745275 TCCCGCACCGGAGCTGCAGGTGG + Intergenic
1004689021 6:17976140-17976162 TCCCGCACCGGGGCTGCAGGTGG + Intronic
1004861315 6:19806956-19806978 TCCCGCACTGGGGCCGCAGGTGG + Intergenic
1004865979 6:19854379-19854401 TCCCGCACCGGGGCTGCAGGCGG + Intergenic
1004906279 6:20239428-20239450 TCCGGCACCGGGGCCGCAGGTGG - Intergenic
1004906864 6:20244716-20244738 TCCCGCACCAGGGCTCCAGGTGG + Intergenic
1004912694 6:20301667-20301689 TCCTGCACTGGGGCTGCAGGTGG - Intergenic
1004914679 6:20320581-20320603 TCACACACTGGGGCTGTAGGTGG - Intergenic
1005035497 6:21552228-21552250 TCCCGCACCGGGGCTGCAGGTGG + Intergenic
1005042197 6:21609845-21609867 TCCCACACCAGGGCTGCAGGTGG + Intergenic
1005117645 6:22356344-22356366 TCCTGCACCAGGGCCGCAGGTGG + Intergenic
1005332806 6:24765881-24765903 TCCCGCGCCGGGGCTGCAGGTGG + Intergenic
1005561503 6:27045648-27045670 TCCCGCACTGGGGCCGCAGGTGG - Intergenic
1005596135 6:27381013-27381035 TCCCGCACCAGGGCTGCAAGTGG + Intronic
1005600794 6:27424773-27424795 CCCCGCGCTGGGGCTGCAGGTGG + Intergenic
1005707377 6:28469299-28469321 TCCCGCACTGGGGCTGCAGGTGG + Intergenic
1005724992 6:28639730-28639752 TCCCGCACCAGGGATGCAGGTGG + Intergenic
1005749851 6:28872537-28872559 TTCCGCACTGGGGCTGCAGGTGG + Intergenic
1005751230 6:28885080-28885102 TCCCGCACTGGGGCCACGGGCGG + Intergenic
1005758820 6:28949739-28949761 TCCCGCACCGGGGTTGCAGGTGG + Intergenic
1005759878 6:28958259-28958281 TCCTGCACCGGGGCTGTAGGTGG - Intergenic
1005766391 6:29015495-29015517 TCCTGCACCCGGGCCGCAGGCGG - Intergenic
1005976935 6:30807387-30807409 CCCCACACTGGGGCTGCAGGTGG + Intergenic
1005978158 6:30816243-30816265 TCCAGCACCGGGGCTGCAGGTGG + Intergenic
1006005848 6:31000880-31000902 TCCCGCACCGGGGCTGCAGGTGG - Intergenic
1006007894 6:31017213-31017235 TCCCGCACCTGGGCCGCAGATGG - Intronic
1006008385 6:31021135-31021157 TCCCGCCCCGGGGCCGCAGGTGG - Intronic
1006033709 6:31195876-31195898 TCCCGCACCGGGGCTGCAGGTGG - Intergenic
1006128025 6:31852430-31852452 TCCCGCACTGGGGCCGCAGGTGG - Intergenic
1006226995 6:32547869-32547891 TCCCGCACCAGGGCTGCAGGTGG + Intergenic
1006352716 6:33532805-33532827 TCCCGCACTGGGGCTGCAGGTGG - Intergenic
1006477906 6:34269441-34269463 TCCCGCACCGGGGCTGCAGGTGG - Intergenic
1006696082 6:35931685-35931707 TCCCGCACTGGGGCTGCAGGTGG - Intergenic
1006748825 6:36364177-36364199 TCCTGCACTGGGGCTGCAGGTGG + Intronic
1006806749 6:36793900-36793922 TCGCCCACTGGGGCTGGAGGTGG - Intronic
1006978290 6:38124274-38124296 TACCGCACTGGAGCCGCAGGTGG + Intronic
1007366597 6:41398415-41398437 TCCGCCCCAGTGGCTGCAGGGGG - Intergenic
1007738799 6:43998471-43998493 TCCTGCACCAGGGCTGCAGGTGG - Intergenic
1008005518 6:46405712-46405734 TCTCGCACCGGGGCTGCAGGTGG + Intronic
1008254141 6:49275858-49275880 TCCCACACCGGGGCTGCAGGTGG - Intergenic
1008270113 6:49481772-49481794 GCCCACACTGGGGCTGCAGGTGG + Intronic
1008270422 6:49483367-49483389 TCCCACACTGGGGCTGCAGGTGG + Intronic
1008284264 6:49629494-49629516 TCCCGCACCAGGCATGCAGGTGG + Intronic
1008567898 6:52786899-52786921 TCCCACACCGGGGCTGCAGGTGG - Intergenic
1008771071 6:54979651-54979673 TCCCGCACCAGGGCTGCAGGTGG - Intergenic
1009260405 6:61479282-61479304 TCCCGGACAGGGCCAGCAGAGGG + Intergenic
1009470341 6:64024149-64024171 TCCCGCACCAGGGCTGCAGGTGG - Intronic
1009510738 6:64547671-64547693 TCCCATACTGGGGCTGCAGGTGG + Intronic
1009587720 6:65627956-65627978 TCCCGCACCGGGGCTGCAGGTGG - Intronic
1009800784 6:68533805-68533827 TCTGGCACTGGGGCTGCAGGTGG - Intergenic
1009872342 6:69467625-69467647 TCCCACACCAGGGCCGCAGGTGG - Intergenic
1010199239 6:73268819-73268841 TCCTGCACCAGGGCTGCAGGTGG + Intronic
1010235571 6:73572477-73572499 TCCCGCACTGGGGGGGCAGGTGG + Intergenic
1010277886 6:73990612-73990634 TCAGGCACCAGGGCTGCAGGTGG + Intergenic
1010617458 6:78030217-78030239 TCCCGCACCGGGGCTGCAGGTGG - Intergenic
1010810034 6:80290319-80290341 TCTTGATCAGGGGCTGCAGGAGG - Intronic
1011143765 6:84189783-84189805 TCCCGCACCGGGGCTGCAGGTGG - Intronic
1011178184 6:84587806-84587828 TCCCGCATTGGGGCTGCAGGTGG - Intergenic
1011246593 6:85326383-85326405 TCCCGCACCAGGGCTGCAGGTGG - Intergenic
1011338282 6:86284764-86284786 TCCCGCACCAGAACTGCAGGTGG + Intergenic
1011601659 6:89065328-89065350 TCCCGCACCGGGGCTGTAGGTGG - Intergenic
1011620029 6:89234434-89234456 TCCTGCACCAGGGCTGCAGGTGG + Intergenic
1011870011 6:91881839-91881861 TCCCGCACCCGGGCTGCAGGTGG + Intergenic
1011974833 6:93283020-93283042 TCCCGCACCGGGGCCGCAGGTGG - Intronic
1012189268 6:96260891-96260913 TCCCACACAGGGGCCGCAGGTGG + Intergenic
1012203549 6:96435410-96435432 TCCCCAACAGGGGCTACAGCAGG - Intergenic
1012578157 6:100829177-100829199 TCCCGCACCTGGGCTGCAGGTGG + Intronic
1012760428 6:103294349-103294371 TCCCGCACCGGGGCTGCAGGTGG + Intergenic
1012939887 6:105404390-105404412 TCCCTCACAGTGGCAGAAGGAGG - Intergenic
1013080300 6:106806171-106806193 TCCCGCACCGGGGCTGCAGGTGG - Intergenic
1013081410 6:106816707-106816729 TCCCGCACCAGGGCTGCAGGTGG + Intergenic
1013100366 6:106981341-106981363 TCCTGCACAGGGGTGGAAGGGGG - Intergenic
1013143493 6:107364190-107364212 TCCCGCACTGGGGCTGCAGGTGG + Intronic
1013410712 6:109881091-109881113 TCCTGCACCGGGGCTGCAGGTGG + Intergenic
1013694735 6:112689312-112689334 TCCCGCACCGGGGCTGCAAGTGG + Intergenic
1013853304 6:114541795-114541817 TCCTGCACCAGGGCCGCAGGTGG + Intergenic
1013955271 6:115834545-115834567 TCCTGCACCCGGGTTGCAGGTGG + Intergenic
1013960151 6:115889461-115889483 TCCTGCACTGGGGCCGCAGGTGG - Intergenic
1013963377 6:115928027-115928049 TCCCGCACCAGGGCTGCAGGTGG + Intergenic
1014055959 6:117015168-117015190 TCTCGCACTGGGGCTGCAGGTGG - Intergenic
1014240817 6:119015739-119015761 TCCCGCACCGGGGCTGCAGGTGG - Intronic
1014280878 6:119441419-119441441 TCTCGCACTGGGGCTGCAGGTGG - Intergenic
1014460195 6:121686400-121686422 TCCCGCACTGGGGCTGCAGGTGG + Intergenic
1014499207 6:122165073-122165095 TCCCACACCGGGGCCGCAGGTGG + Intergenic
1014507835 6:122280995-122281017 TCCCGCACCTGGGCTACAGGTGG - Intergenic
1014718632 6:124892388-124892410 TCCCGCACTAGGGCTGCAGGTGG - Intergenic
1014739077 6:125126269-125126291 TCCCGCACTGGGGCTGCAGGTGG - Intronic
1014788547 6:125644868-125644890 TCCTGCACCGGGGCTGCAGGTGG - Intergenic
1014920999 6:127214535-127214557 TCCGGCACCGGGGCTGCAGGTGG + Intergenic
1015572176 6:134633489-134633511 TCCCGCACCGGGGCCACGGGTGG + Intergenic
1015600421 6:134905145-134905167 TCCCGCACCAGGGCTGCAGGTGG - Intergenic
1016067296 6:139697869-139697891 TCCTGCACCGGGGCTGCAGGTGG + Intergenic
1016069821 6:139726281-139726303 TCCCTCACCGGGGCTGCAGGTGG + Intergenic
1016092754 6:139999529-139999551 TCCCGCACTGGAGCTGCAGGTGG + Intergenic
1016217276 6:141618629-141618651 TCCTGCACCGGGGCTGCAGGTGG - Intergenic
1016482240 6:144495095-144495117 TCCCGCACCCGGGCTGCAGGTGG + Intronic
1016858725 6:148697138-148697160 TCCCCCACCGGGGCCACAGGTGG + Intergenic
1016858847 6:148697991-148698013 TCTTGCACGGGGGCTACAGGTGG + Intergenic
1017299054 6:152834759-152834781 TCCCGCACCGGGGCTGCAGGTGG - Intergenic
1017325167 6:153134037-153134059 TCCCGTACTGGGGCTGCAGGTGG - Intergenic
1017537449 6:155363486-155363508 TCCCGCACCAGGGCTGCAAGTGG - Intergenic
1017581141 6:155866700-155866722 TCCCGCACCGGGGCTGCAGGTGG + Intergenic
1017839420 6:158209696-158209718 CCCCGCACCGGGGCTGCAGGTGG + Intergenic
1018064162 6:160114462-160114484 TCCCACACCGGGGCTGCAGGTGG + Intergenic
1018545742 6:164933712-164933734 TCCCGCACCCGGGCTGCAGGTGG - Intergenic
1018573306 6:165233228-165233250 TCCCAGCCAGGGGCTGCAGCTGG + Intergenic
1018624573 6:165765232-165765254 TCCCGCACGGGGGCTGCAGGTGG + Intronic
1018696121 6:166393297-166393319 TCCTGCACCGGGGCCGCAGGTGG + Intergenic
1018827557 6:167421267-167421289 ACCCGCCCAGGGGCTCCAGGGGG - Intergenic
1019000190 6:168743729-168743751 TCCCGCACCGGGGCTGCAGGTGG + Intergenic
1019497304 7:1346551-1346573 CCCCGCACATGGGCTGAGGGTGG - Intergenic
1019656892 7:2200762-2200784 GCACGCTCAGTGGCTGCAGGGGG - Intronic
1019795392 7:3044367-3044389 TCCAGAACAGGGGCTGAGGGAGG - Intergenic
1019944190 7:4313882-4313904 TCCCGCACAGGGGCTGCAGGTGG + Intergenic
1019965679 7:4496875-4496897 TCCCGCACAGGGGCTGCAGGTGG + Intergenic
1020163987 7:5793908-5793930 TCCCGCACTGGGGCCGCAGGTGG - Intergenic
1020784359 7:12556107-12556129 TCCCACACTGGGGCTGCAGGTGG + Intergenic
1021133947 7:16943401-16943423 TCCCGCACTGGGGCCGCAGACGG - Intergenic
1021324198 7:19245899-19245921 TCCCGCACCTGGGCTGCAGGTGG - Intergenic
1021513729 7:21461143-21461165 TTTCGCACCAGGGCTGCAGGTGG + Intronic
1021520639 7:21536534-21536556 TCCCACACCGGGGCCGCACGTGG + Intergenic
1021567452 7:22029054-22029076 TCCAGCACTGGGGCCGCAGGTGG - Intergenic
1021567821 7:22032312-22032334 TCCCGCACTGGGGCCGCAGGTGG + Intergenic
1022141936 7:27500200-27500222 CCCCGTCCAGGGGCTGCATGGGG + Intergenic
1022174075 7:27857001-27857023 TCCTGCACCAGGGCCGCAGGTGG + Intronic
1022310472 7:29192247-29192269 TACAGCACAGGGCCTTCAGGTGG + Intronic
1022750511 7:33219388-33219410 CCCTGCACTGGGGCTGCAGGTGG - Intronic
1022861025 7:34367040-34367062 TCAGGCAGAGGGGCTGCAGATGG + Intergenic
1023128008 7:36974153-36974175 TACCACACCGGGGCTGCAGGTGG - Intronic
1023396135 7:39753895-39753917 TCTCGCACCTGGGCCGCAGGTGG + Intergenic
1023835172 7:44063696-44063718 CCCAGCTCAGGGGCTGCAGGAGG - Intronic
1024269152 7:47628892-47628914 TCCCGCACCGGGGCTGCAGGTGG - Intergenic
1024335559 7:48202858-48202880 TCCCGCACCAGGGCTGCAGGTGG + Intronic
1024443907 7:49454049-49454071 TCCTGCACTGGAGCTGCAGGTGG - Intergenic
1024465979 7:49711672-49711694 TCCCACACTGGGGCTGCAGGTGG - Intergenic
1024670097 7:51586383-51586405 ACCTGCACTGGGGCAGCAGGTGG - Intergenic
1024691356 7:51806249-51806271 CTCGGCACTGGGGCTGCAGGTGG - Intergenic
1024700562 7:51900830-51900852 TCTGGCACTGGGGCTGCAGGTGG + Intergenic
1024735740 7:52302839-52302861 TCCCGCACAAGGGCCACAGGTGG + Intergenic
1024741841 7:52363022-52363044 TCCCGCACCTGGGCTGCAGGTGG - Intergenic
1024748128 7:52431187-52431209 TCCCGCGCCGGGGCCGCAGGCGG + Intergenic
1024825355 7:53385106-53385128 TCCCGCACCAGGGCTGCAGGTGG + Intergenic
1024834120 7:53495436-53495458 TCCCGCACTGGGGCTGCAGGTGG - Intergenic
1025034971 7:55588294-55588316 TCCCGCACAGCGCCTGCACGTGG - Intergenic
1025962004 7:66231306-66231328 TCCCGCACCGGGGCTGCATGTGG + Intronic
1026187020 7:68090359-68090381 TCCCACAACGGGGCTGCAGGTGG + Intergenic
1026203019 7:68231447-68231469 TTTCGCACTGGGGCTGCAGGTGG - Intergenic
1026335966 7:69394241-69394263 TCCCGCACCGGGGCTGCAGGTGG - Intergenic
1026512415 7:71038010-71038032 TCCTGCACCGGGGCTGCAGGTGG - Intergenic
1026516641 7:71078402-71078424 TCCCACACCGGGGCTGCAGGTGG - Intergenic
1026949397 7:74337448-74337470 TCCCACATAGGGGCCACAGGGGG + Intronic
1027561748 7:79739716-79739738 TCCCGCACCGGGGCTGCAGGTGG - Intergenic
1027563968 7:79767910-79767932 TCCCGCATCGGGGCTGCAGGTGG + Intergenic
1027579641 7:79977549-79977571 TCCTGCACTGGGGCTGCAGGTGG + Intergenic
1027665965 7:81043123-81043145 TCCTGCACTGGGGCTGCAGGTGG - Intergenic
1027667463 7:81057428-81057450 TCCCGCACCAGGGCTGCAGGTGG + Intergenic
1027674551 7:81142153-81142175 TCCCGCACCGGGGCCGCAGGTGG - Intergenic
1027698210 7:81437035-81437057 TCCCGCACTGGGGCTACAGGTGG + Intergenic
1027779022 7:82499985-82500007 TCCCACACTGGGGCTGCAGGTGG - Intergenic
1027868171 7:83673726-83673748 TCCCGCACTGGGGCTGCAGGTGG - Intergenic
1028070175 7:86440983-86441005 TCCAGCACCAGGGCTGCAAGTGG - Intergenic
1028142570 7:87289139-87289161 TCCTGCACACGGGCCGCAGGTGG - Intergenic
1028511143 7:91627338-91627360 TCCCGCACCAGAGCTGCAGGTGG + Intergenic
1028727237 7:94101250-94101272 TCCCGCACTGGGGCCACGGGCGG - Intergenic
1028778396 7:94705908-94705930 TCCCGCACCGGGGCTGCAGGTGG - Intergenic
1028852444 7:95552411-95552433 TCCCACACCGGGGCTGCAGGTGG + Intergenic
1028913065 7:96229123-96229145 TCCCGCACTGGGGCTGCGGGCGG - Intronic
1029076211 7:97936297-97936319 TCCCGCACAGGAGCTGCAGGTGG - Intergenic
1029438942 7:100576961-100576983 TCCCAAGCAGGGGCTGCAGCGGG - Exonic
1029567579 7:101348990-101349012 TCCCACACCGGGGCTGCAGGTGG - Intergenic
1029809566 7:103034189-103034211 TCTCGCACTGGGGCTGCAGGTGG + Intronic
1029832305 7:103274870-103274892 TCCTGCACTGGGGCTGCAGGTGG + Intergenic
1029904026 7:104072175-104072197 TTCCGCACTGGGGCTGCAGGTGG - Intergenic
1029988237 7:104940568-104940590 TTCTGCACGGGGGCTTCAGGTGG - Intergenic
1030215658 7:107042307-107042329 TCCCGCACTGGGGCTGCAGGTGG + Intergenic
1030292721 7:107888233-107888255 TCCTGCGCTGGGGCGGCAGGCGG - Intergenic
1030366950 7:108657195-108657217 TGCTGCACTGGGGCTGCAGGTGG + Intergenic
1030733562 7:113017761-113017783 TCCCGCACCGGGGCTGCAGGTGG - Intergenic
1030780487 7:113593733-113593755 TCCCGCACCGGGACTGCAGGTGG - Intergenic
1030819244 7:114076796-114076818 TACGGCACCGGGGCTGTAGGTGG + Intergenic
1030980621 7:116181928-116181950 TCCCGCACTGGGGCTGCAGGCGG + Intergenic
1031056464 7:116997942-116997964 TCCCGCACTGGGGCTGCAGGTGG + Intronic
1031110036 7:117596524-117596546 TCCCGCACTGGGGCTGCAGGTGG - Intronic
1031292189 7:119951456-119951478 TCCCACACTGGGGGTGCAGGTGG + Intergenic
1031409282 7:121422142-121422164 TCCCGCACTGGGGCCACAGGTGG - Intergenic
1031902942 7:127429579-127429601 TCCTGCACCAGGGCCGCAGGCGG - Intronic
1032083117 7:128869845-128869867 CCCCGCACCGGGGGAGCAGGAGG - Intronic
1032248142 7:130230437-130230459 TCCCGCACAGGGGCTGCAGGTGG - Intergenic
1032339722 7:131059176-131059198 TCCCACACTGGGGATGCAGGCGG - Intergenic
1032561531 7:132898552-132898574 TCCCGCACCCAGGCTGCAGGTGG + Intronic
1032781671 7:135169287-135169309 GTCAGCACAGAGGCTGCAGGAGG - Intronic
1033065145 7:138146536-138146558 TCTCGCACTGGGGCTGCAGGTGG - Intergenic
1033221152 7:139526797-139526819 CCCCCAGCAGGGGCTGCAGGAGG - Intronic
1033312359 7:140271290-140271312 TCCCGCACCCGGGTCGCAGGTGG + Intergenic
1033394023 7:140956900-140956922 TCCTGCACTGGGGCTGCAGGTGG + Intergenic
1033664030 7:143424343-143424365 TCCCGCACCAGGGCTGTAGGTGG + Intergenic
1033758543 7:144417915-144417937 TCCCGCACCAGGGCCGCAGGTGG + Intergenic
1033779395 7:144650839-144650861 TCCCGCACCGGGGCTGCAAGTGG - Intronic
1033816726 7:145082795-145082817 TCCCCCACAGCAGCTGCAGCAGG - Intergenic
1033866574 7:145697358-145697380 TCCCGCACCGGGGCCGCAGGTGG + Intergenic
1034091119 7:148364223-148364245 TCCCGCACTGGGGCTGCAGGTGG - Intronic
1034097987 7:148426823-148426845 TCCCGCACTGGGGCTGCAGGTGG - Intergenic
1034155091 7:148949496-148949518 TCCCGCACCGGGGCTGCAGGTGG - Intergenic
1034167684 7:149038644-149038666 TCCCACACCGGGGCTGCAGGTGG + Intergenic
1034265260 7:149777628-149777650 CCCCTGCCAGGGGCTGCAGGAGG - Intergenic
1034267917 7:149790119-149790141 TCTCGGGAAGGGGCTGCAGGTGG + Intergenic
1034460046 7:151193113-151193135 CCCACCACAGGGGCTGCAGGGGG + Intronic
1034488583 7:151381275-151381297 CCCACCTCAGGGGCTGCAGGCGG - Exonic
1034547194 7:151796833-151796855 CTCCGTACAGGGGCTGGAGGTGG - Intronic
1034632069 7:152538833-152538855 TCCCGCACCGGGGCTGCAGGTGG + Intergenic
1034655965 7:152730221-152730243 TCCCGCACCGGGGCTGCAGGTGG + Intergenic
1034967026 7:155398090-155398112 TCTCGCACTGGGGCTGCAGGTGG + Intergenic
1035151115 7:156873951-156873973 TTCCGCACTAGGGCTGCAGGTGG + Intronic
1035325485 7:158062984-158063006 TCCTGCACCAGGGCCGCAGGCGG - Intronic
1035663756 8:1365304-1365326 CTCCGCACCGAGGCTGCAGGTGG + Intergenic
1035999313 8:4583243-4583265 TCCCGCACCACGGCTGCAGGTGG - Intronic
1036123755 8:6045006-6045028 TCCCACACGGAGGCTGCAGGTGG + Intergenic
1036260534 8:7236065-7236087 CCCAGCACAGGAGCTGCAGGTGG - Intergenic
1036306079 8:7603457-7603479 CCCAGCACAGGAGCTGCAGGTGG + Intergenic
1036312571 8:7694621-7694643 CCCAGCACAGGAGCTGCAGGTGG - Intergenic
1036356925 8:8051442-8051464 CCCAGCACAGGAGCTGCAGGTGG + Intergenic
1036378332 8:8219287-8219309 TCCCACACGGGGGTCGCAGGTGG - Intergenic
1036440956 8:8781337-8781359 TCCCGCACCGGGGCTGCAGGTGG + Intergenic
1036554592 8:9847745-9847767 TCCCGCACCAGGGCCGCAGATGG + Intergenic
1036831423 8:12023017-12023039 TCCCGCACAAGAGCCGCAGGTGG - Intergenic
1036901646 8:12673820-12673842 TCCCACACAGGAGCCACAGGTGG - Intergenic
1036915049 8:12796678-12796700 TCCTGCACCGGGGCTGCAGGTGG - Intergenic
1037239432 8:16760486-16760508 TCCCACACCAGGGCTGCAGGAGG + Intergenic
1037241625 8:16784321-16784343 TCCCACACCGGGGCTGCAGGTGG - Intergenic
1037263772 8:17036763-17036785 TCCCGCACCAGGGCTGCAGGTGG + Intronic
1037348394 8:17923453-17923475 TCCCCGACAGGGCCAGCAGGAGG - Intronic
1037425538 8:18750989-18751011 TCCCGCACCGGGGCTGCAGGTGG + Intronic
1037559005 8:20055140-20055162 TCTCGCACAGGGGCCGCAGGTGG - Intergenic
1037811056 8:22086983-22087005 TCCCGCACCGGGGCTGCAGGTGG - Intergenic
1037957475 8:23070726-23070748 TCCCGCACCGGGGTTGCAGGTGG + Intergenic
1037971267 8:23173744-23173766 TCCCGCACTGGGGCTGCAGGTGG + Intergenic
1037983599 8:23272531-23272553 TCCCGCACGGGGGCTGCAGGTGG - Intronic
1038174139 8:25164910-25164932 TCCCGCACCGGGGCTGCAGGTGG - Intergenic
1038638348 8:29304669-29304691 TCCTGCACAGGGGCTGCAGGTGG - Intergenic
1038870769 8:31490282-31490304 TCTCGCACTGGGGCTGCTGGTGG - Intergenic
1039061371 8:33574318-33574340 TCCCGCACAGGGGCTGCAGGTGG - Intergenic
1039068807 8:33632095-33632117 TCCTGCACCGGGGCCGCAGGTGG - Intergenic
1039069035 8:33633773-33633795 ACCCGCACTGCGGCTGCAGGTGG + Intergenic
1039284925 8:36029241-36029263 TCCTGCACTGGGGCTGCAGGTGG - Intergenic
1039587679 8:38720211-38720233 TCGGGCACCGGGGCTGCAGGTGG - Intergenic
1039637377 8:39180542-39180564 TCCCGCACCAGGGCTGCAGGTGG - Intronic
1040003620 8:42600002-42600024 TCCCACGCCAGGGCTGCAGGCGG + Intergenic
1040014549 8:42689927-42689949 TGCCACACCAGGGCTGCAGGTGG - Intergenic
1040026615 8:42787170-42787192 TCCCGCACCAGGGCCGCAGGTGG - Intronic
1040276450 8:46016437-46016459 TCCTGCACAGGGTCTGTGGGGGG - Intergenic
1040324021 8:46332104-46332126 TCCCACACCAGAGCTGCAGGTGG - Intergenic
1040351344 8:46571940-46571962 TCCTGCACTGGGGCCGCAGGTGG - Intergenic
1040622157 8:49102948-49102970 TCTCGCACCGGGGCCACAGGTGG + Intergenic
1040723198 8:50350333-50350355 TCCCGCACCAGGGCCACAGGTGG - Intronic
1040952638 8:52952802-52952824 TCCCGCACCAGGGCTGCAGGTGG + Intergenic
1040954849 8:52969779-52969801 TCTCACACTGGGGCTGCAGGTGG + Intergenic
1041034590 8:53775846-53775868 TCCCGCACTGGGGCTGCAGGTGG + Intronic
1041914593 8:63126489-63126511 TCCCGCACCGGGGCTGCAGGTGG - Intergenic
1041919000 8:63162404-63162426 TCCCGCACCAGGGCTGCAGGTGG - Intergenic
1042512500 8:69626430-69626452 TCCCGCACAGGGGCTGCAGGTGG + Intronic
1042948683 8:74179477-74179499 TCCCGCACAGGGGCCGGAGGCGG + Intergenic
1043073270 8:75665411-75665433 TCCCGCACCGGGGCCGCAGGTGG + Intergenic
1043110170 8:76169986-76170008 TCATGCACTGGGGCTGCAGGTGG - Intergenic
1043129864 8:76447561-76447583 TCCCGCACGGGGACTGCAGGTGG + Intergenic
1043346532 8:79303909-79303931 TCCCGCTCCCGGGCTGCAGGTGG - Intergenic
1043352420 8:79377149-79377171 TCCCGCACCGGGGCAGCAGGTGG + Intergenic
1043435398 8:80232223-80232245 TCCCGCACCGGGCCTGCAGGTGG - Intergenic
1043640234 8:82441793-82441815 TCCCTTACCGGGGCTGCAGGTGG - Intergenic
1043701191 8:83290765-83290787 TCCTGCACCGGGGCTGCAGGTGG - Intergenic
1043709956 8:83403361-83403383 TCCCACACCGGGGCTGCAGGTGG - Intergenic
1043857228 8:85276441-85276463 TCTCGCACCAGGGCTGCAGGTGG - Intronic
1044075894 8:87821249-87821271 TCCTGCACCGGGGCTGCAGGTGG - Intergenic
1044404956 8:91816736-91816758 TCCCGCACCTGGGCTGCAGGTGG - Intergenic
1044633402 8:94300279-94300301 TCCCACACCGGGGCAGCAGGTGG + Intergenic
1044788759 8:95824054-95824076 TCCCGCACCAGGGCTACAGATGG - Intergenic
1044862086 8:96533792-96533814 TCCTGCACTGGGGCCACAGGTGG + Intronic
1044880598 8:96719032-96719054 TCCCGCACCGGGGCTGCAGGTGG + Intronic
1045131873 8:99163345-99163367 TCCCGCACCGGGGCTGCAGGTGG + Intronic
1045232257 8:100316718-100316740 TCCCGCACCAGGGCTGCAGTTGG + Intronic
1045467689 8:102485459-102485481 TCCCGCACCAGGGCTGCAGGTGG + Intergenic
1046208817 8:111040783-111040805 TCTCGCACTGGGGCTGCAGGTGG + Intergenic
1046265323 8:111823236-111823258 TCCCGCACTGGAGCTGCAGGTGG + Intergenic
1046284983 8:112082965-112082987 TCCCGCAAGGGGGCTGCAGGTGG + Intergenic
1046288980 8:112133107-112133129 TCCCGCACCAGGGCTGCAAGTGG - Intergenic
1046445412 8:114311765-114311787 TCCCGCACCAGGGCTGCAGGTGG - Intergenic
1046450781 8:114386570-114386592 TCCCGCACCAGGGCTGCAGGTGG - Intergenic
1046521324 8:115330512-115330534 TCCCACACAGGGGCCACGGGAGG + Intergenic
1046621279 8:116531459-116531481 TCCCGCACGGGGCCTGCAGGTGG - Intergenic
1047100119 8:121667391-121667413 TCACACACCGGGGCTGCAGGTGG + Intergenic
1047631631 8:126714583-126714605 CCCCGCACTGGGGCCACAGGTGG + Intergenic
1048575970 8:135690403-135690425 TTCCACACTGGGGCTGCAGGTGG + Intergenic
1049087564 8:140490462-140490484 TCCCACACTGGGGCTGCAGGCGG + Intergenic
1049157763 8:141077055-141077077 TCCCGCACCGGGGCTGCAGGTGG - Intergenic
1049267705 8:141677966-141677988 TGCTGCACAGGGGCTGCTGATGG - Intergenic
1049637121 8:143695022-143695044 CCCAGCGCAGAGGCTGCAGGAGG - Exonic
1049944440 9:580717-580739 TCCCGCACTGGGGCCGCAGGCGG + Intronic
1050892073 9:10836371-10836393 TCCTGCACGGGGGCCGCAGGTGG - Intergenic
1050920685 9:11197280-11197302 TCCTGCACTGGGGCTGCAGGTGG - Intergenic
1050975192 9:11928848-11928870 TCCCACACCGGGGCCACAGGTGG + Intergenic
1051305015 9:15699990-15700012 TCCCGCACCCGGGCTGCAGGTGG + Intronic
1051439926 9:17073017-17073039 TCCCGCACGGGGGCTGCAGGTGG - Intergenic
1051449329 9:17178358-17178380 TCCCGCACCCGGGCCGCAGGTGG + Intronic
1051459273 9:17294628-17294650 TCCCGCACAGGGGCCACAGGTGG + Intronic
1051463871 9:17354350-17354372 TCCCGCACCGGGGCTGCAGGTGG - Intronic
1051892764 9:21959665-21959687 TCCTGCACCAGGGCTGCAGGTGG - Intronic
1052056608 9:23914405-23914427 TCCCGCACTGGGGCCGCAGGTGG + Intergenic
1052075518 9:24135481-24135503 TCCTGCACCGGGGCTGCAGGTGG - Intergenic
1052155779 9:25188542-25188564 TGCTGCACAGGGCCTGCAGAAGG + Intergenic
1052313493 9:27093025-27093047 TCCCCCATCGGGGCTGCAGGTGG - Intergenic
1052473439 9:28928878-28928900 TCCTGCCCAGGGGTTTCAGGAGG + Intergenic
1052979623 9:34438360-34438382 TCCCGCACCGGTGCTGCAGGTGG - Intronic
1053027210 9:34740182-34740204 TTCCGCACCGGGGCTGCGGGTGG + Intergenic
1053381220 9:37650932-37650954 TCCCGCGCCGAGGCTGCAGCCGG - Intronic
1053416412 9:37949626-37949648 TCCCGAAATGGGGCTGCAGCAGG + Intronic
1053436159 9:38075738-38075760 TCCTGTCCCGGGGCTGCAGGTGG - Intergenic
1053547842 9:39042303-39042325 TCCCGCACAGGGGCTGCAGGTGG + Intergenic
1053811966 9:41862344-41862366 TCCCACACCGGGGCTGCAGGTGG + Intergenic
1053928349 9:43089777-43089799 TCCCGCGCTGGGGCCGCTGGGGG - Intergenic
1054285358 9:63163514-63163536 TCCCGCGCTGGGGCCGCTGGGGG + Intergenic
1054291444 9:63296970-63296992 TCCCGCGCTGGGGCCGCTGGGGG - Intergenic
1054389462 9:64601509-64601531 TCCCGCGCTGGGGCCGCTGGGGG - Intergenic
1054618629 9:67325095-67325117 TCCCACACCGGGGCTGCAGGTGG - Intergenic
1054722526 9:68617438-68617460 TCCGGCACCAGGGCTGCAGGTGG - Intergenic
1055049434 9:71963952-71963974 TCCCACTCCGGGGCTGCAGATGG - Intronic
1055102498 9:72480185-72480207 TCCCGCACCAGGGCTGCAGGTGG + Intergenic
1055461391 9:76523674-76523696 TCCCACACAGGGGCTGCAGGTGG + Intergenic
1055557512 9:77490330-77490352 TCCCACACTGGGGTTGCAGGTGG + Intronic
1055651443 9:78410409-78410431 TCCCGCACTGGGGCTGCAGGTGG - Intergenic
1055814083 9:80185237-80185259 TCCAGCACCAGGGCCGCAGGTGG + Intergenic
1055985455 9:82054327-82054349 TCCTGCACCGGGGCCACAGGCGG + Intergenic
1056736003 9:89209773-89209795 TCCCACACCAGTGCTGCAGGTGG - Intergenic
1056771323 9:89480364-89480386 TCCCGCACCGGGGCTGCAGGTGG + Intronic
1057075665 9:92136943-92136965 TCCCGGGCTGGGGCTGCTGGGGG + Intergenic
1057383853 9:94591090-94591112 TCCCGCACCGGGGCTGCAGGTGG + Intronic
1057511207 9:95680745-95680767 TGCCGCACGGGGGATGCAGGTGG - Intergenic
1057543790 9:96001665-96001687 TCCCGCACCGGGGCTGCAGGTGG + Intronic
1057628559 9:96700834-96700856 TCCCACACCGGGGCTGCAGGTGG + Intergenic
1057726981 9:97574588-97574610 TCCTGCACCGGGGCCGCAGGTGG - Intronic
1057907120 9:98992065-98992087 TCCCGCACGAGGGCAGCAGGTGG + Intronic
1058174798 9:101724061-101724083 TCCTGCACCGGGGCTGCAGGTGG + Intronic
1058235625 9:102486929-102486951 TCCCATACCAGGGCTGCAGGTGG + Intergenic
1058365248 9:104201008-104201030 TCCTGCATTGGGGCCGCAGGCGG - Intergenic
1058786569 9:108393927-108393949 TCCTGCACCGGGGCTGCAGGTGG - Intergenic
1058887168 9:109330301-109330323 TGCTGCAGAGAGGCTGCAGGAGG - Intergenic
1059791086 9:117642711-117642733 TCCCGCACCGGGGCTGCAGGTGG + Intergenic
1059891380 9:118809205-118809227 TCCCGCACCTGGGCGGCAGGTGG + Intergenic
1059991491 9:119870228-119870250 TCCCGCACCGGGGCTGCAGTTGG + Intergenic
1060091414 9:120746759-120746781 TCCCGCACCCGGGCTGCAGGTGG - Intergenic
1060305309 9:122406145-122406167 TCCCGCAGCGGGGCCGCAGGTGG + Intergenic
1060340545 9:122771804-122771826 GGCCTCTCAGGGGCTGCAGGGGG + Intergenic
1060594159 9:124838679-124838701 TCCCGCACCAGGGCTGCAGGTGG + Intergenic
1060934522 9:127507472-127507494 TCCAGCACAGGGGCGGCTGTGGG - Intronic
1061001382 9:127904814-127904836 TCCCCCACAGAGGCTGGAGAGGG + Intronic
1061236458 9:129345915-129345937 ACCCTCACAGTGGCTCCAGGAGG - Intergenic
1061483901 9:130910536-130910558 TCCCGCACCGGGACTGCAGGTGG - Intronic
1062146139 9:134990978-134991000 TCCCGCACTGGGGCTGCAGGTGG + Intergenic
1062381596 9:136289585-136289607 TCCCCCACAAGGGCTGCAGGAGG + Intronic
1062432059 9:136530631-136530653 TCCCGCAGTGGAGCAGCAGGTGG - Intronic
1203460364 Un_GL000220v1:30967-30989 TCCCACACCAGGGCCGCAGGTGG + Intergenic
1203662807 Un_KI270753v1:61350-61372 TCCTGCACCAGGGCCGCAGGTGG + Intergenic
1203670559 Un_KI270755v1:7346-7368 TCCTGCACCAGGGCCGCAGGTGG - Intergenic
1185802308 X:3024097-3024119 CCCCGTCCAGGGGCTCCAGGTGG - Exonic
1186152526 X:6690454-6690476 TCCCGCACCGGGGCTGCAGGTGG + Intergenic
1186295583 X:8144917-8144939 TCCTGCACTGGGGCCGCAGGTGG + Intergenic
1186323183 X:8452437-8452459 TCCCGCACCGGGGCTGCAGGTGG + Intergenic
1187005778 X:15231677-15231699 TCCCGTACGAGGGCTGCAGGTGG + Intergenic
1187139123 X:16575866-16575888 TCCCGCACTGGGGCTGCAGGTGG - Intergenic
1187304674 X:18084217-18084239 TCCCACACTGGGGCTGCAGGTGG - Intergenic
1187557506 X:20366796-20366818 TCCCGCACTGGGGCTGCAGGTGG + Intergenic
1187904082 X:24050106-24050128 TCCGGCACCGGGGCTGCAGGTGG - Intergenic
1188112069 X:26205173-26205195 TCTCCCACTGGGGCTGCAGGTGG - Intergenic
1188166894 X:26873647-26873669 TCCCGCACTGGGGCTGCAGGTGG + Intergenic
1188189595 X:27157417-27157439 TCCCGCACTGGGGCTGCAGGTGG - Intergenic
1188242746 X:27809705-27809727 TCCCGCACTGGGGCCGCAGGTGG - Intronic
1189209903 X:39275994-39276016 TCCCGCACCAGGGCCACAGGTGG - Intergenic
1190045799 X:47110950-47110972 TCCCGCACCTGGGCTGCAGGTGG + Intergenic
1190260857 X:48795983-48796005 TCCAGCACAGGTTCTGAAGGGGG - Intergenic
1190413897 X:50163278-50163300 TCCTGCACCGGGGCTGCAGGTGG + Intergenic
1191618571 X:63192519-63192541 TCCCGCATCGGGGCTGCAAGTGG + Intergenic
1192186822 X:68952528-68952550 TCCCGCACTGGGGCTGCAGGTGG - Intergenic
1192251479 X:69417176-69417198 TCCCGCACTGGGGCCACAGGTGG - Intergenic
1192869596 X:75173544-75173566 TCCTACACCGGGGCTGCAGGTGG + Intergenic
1193040140 X:76996605-76996627 TCCCGCACTGGGGCTGCAGGTGG + Intergenic
1193271135 X:79530996-79531018 TCTCGCACTGGGGCCGCAGGTGG - Intergenic
1193538090 X:82738150-82738172 TCCCGCACCGGGGCTGCAGGTGG + Intergenic
1193803969 X:85972305-85972327 TCCCGCACCAGGGCTGCAGGTGG + Intronic
1194071534 X:89330976-89330998 TCCCACACTGGGGCTGCAGGTGG + Intergenic
1194121144 X:89965593-89965615 TCTCGCACCGGGGCTGCAGGTGG + Intergenic
1194166413 X:90521749-90521771 TCCCGCACTGGGGCTGCAGGTGG - Intergenic
1194384453 X:93236151-93236173 TCCCGCACTGGGGCCGCAGTTGG - Intergenic
1194650752 X:96512198-96512220 TCCCGCACCGGGGCTGCAGGTGG + Intergenic
1195128192 X:101829544-101829566 TCCAGCACAGGGGTGACAGGAGG + Intergenic
1195178010 X:102329280-102329302 TCCAGCACAGGGGTAACAGGAGG - Intergenic
1195180854 X:102357813-102357835 TCCAGCACAGGGGTAACAGGAGG + Intergenic
1195257968 X:103107295-103107317 TCCCACACTGGGGCTGCAGGTGG + Intergenic
1195694576 X:107657299-107657321 ACCCCAGCAGGGGCTGCAGGTGG + Intergenic
1195896298 X:109749281-109749303 TCCCTCACTGGGGCTGCAGGTGG + Intergenic
1195909537 X:109875841-109875863 TCCCGCACAGGAGCCGCTGGTGG + Intergenic
1196197858 X:112854846-112854868 TCCCGCACAGGGGCTGCAGGTGG + Intergenic
1196319465 X:114270507-114270529 TCCGGCACCGGGGCTGCAGGTGG + Intergenic
1196582758 X:117395094-117395116 TCCCGCACTGGGGCTGCAGTTGG - Intergenic
1196616221 X:117769447-117769469 TCCCGCACCAGGGCTGCATGTGG - Intergenic
1196662462 X:118282688-118282710 TCCCGCACAGGGGCTGCAGGTGG + Intergenic
1196705840 X:118716883-118716905 TCCCGCACTGGGGCTGCAGGTGG + Intergenic
1196714680 X:118799370-118799392 TCCCGCACAGGGGCTGCAGGTGG - Intergenic
1196728865 X:118921930-118921952 TCCCGCACCGGGACTGCAGGTGG + Intergenic
1196741581 X:119029929-119029951 TCCTACACCGGGGCTGCAGGTGG - Intergenic
1196761908 X:119208419-119208441 TCCCGCACCAGGGCTGCAAGTGG + Intergenic
1196762279 X:119210826-119210848 ACCCGCACCAGGGCTGCAGGTGG + Intergenic
1196771569 X:119300095-119300117 TCCCGCACCAGGGCTGCAGGTGG - Intergenic
1196775271 X:119332288-119332310 TCCCGCACCAGGGCTGCAGGTGG - Intergenic
1196781399 X:119387531-119387553 TCCCGCACTGGGCCTGCAGGTGG + Intergenic
1196793915 X:119487810-119487832 TCCCACACTGGGGCTGCAGGTGG + Intergenic
1196827201 X:119750768-119750790 TCCCGCACTGGGGCCGCAGGTGG + Intergenic
1196845123 X:119891004-119891026 TCCCACACCAGGGCTGCAGGTGG - Intergenic
1196860790 X:120025715-120025737 TCCCGCACCTGGGCGGCAGGTGG + Intergenic
1197331108 X:125155415-125155437 TCTCGTACTGGGGCTGCAGGTGG + Intergenic
1197340115 X:125256048-125256070 TCTCGCACTGGGGCTGCAGGTGG - Intergenic
1197344763 X:125319009-125319031 TCCCGCACCAGGGCTGCAGGTGG + Intergenic
1197376731 X:125690525-125690547 TTTCGCACTGGGGCTGCTGGTGG + Intergenic
1197533714 X:127662960-127662982 TCCCGCACAGGGGCCACAGGTGG + Intergenic
1197978823 X:132194499-132194521 TCCCCCACAGGGGCCGCAGGTGG - Intergenic
1198060983 X:133044793-133044815 TCCCACACTGGGGCTGCAGGTGG - Intronic
1198256207 X:134926042-134926064 TCCTGCACAGGGGCCACAGGCGG - Intergenic
1198300054 X:135325868-135325890 TCCTGCACCGGGGCTGCAGGTGG - Intronic
1198468172 X:136921777-136921799 TCCTGCACCGGGGCCGCAGGTGG - Intergenic
1198664247 X:139003972-139003994 TCCTGCACCGGGGCTGCAGGTGG + Intronic
1198694524 X:139321217-139321239 TCCCCCACCGGGGCCGCAGGTGG - Intergenic
1198872249 X:141188485-141188507 TCTCGCACTGGGGCTGCAGGTGG + Intergenic
1198972521 X:142298192-142298214 TCCCGCACAGGGGCTGCAGGTGG + Intergenic
1199009871 X:142745670-142745692 TCCCGCAGCGGGGTGGCAGGTGG + Intergenic
1199050166 X:143228638-143228660 TCCCGCACAGGGGCTGCAGGTGG + Intergenic
1199134104 X:144231198-144231220 TCCCGCACCGAGGCTGCAGGTGG + Intergenic
1199175608 X:144784032-144784054 TCCCGCACCGGGGCTGCAGGTGG - Intergenic
1199356176 X:146866829-146866851 TCCCGCACAGGGGCTGCAGGTGG + Intergenic
1199831212 X:151551133-151551155 TCCTGCACCGGGGCTGCAGGTGG + Intergenic
1199831729 X:151555138-151555160 TCCTGCACCGGGGCTGCAGGTGG + Intergenic
1200423495 Y:2998322-2998344 TCCCGCACCGGGGCTGCAGGTGG + Intergenic
1200470826 Y:3584037-3584059 TCCCACACCAGGGCTGCAGGTGG + Intergenic
1200473998 Y:3623044-3623066 TCTCGCACCGGGGCTGCAGGTGG + Intergenic
1200512682 Y:4099530-4099552 TCCCGCACCGGGGCTGCAGGTGG - Intergenic
1200648744 Y:5816184-5816206 TCCCGCACCAGGGCCGCGGGTGG + Intergenic
1200725772 Y:6666705-6666727 TCCCACACTGGGGCTGCAGGTGG + Intergenic
1200824226 Y:7622163-7622185 TCCCACACCGGGGCTGCAGGTGG + Intergenic
1200888738 Y:8299030-8299052 TCCCGCACCGGGGCTGCAGGTGG - Intergenic
1201285412 Y:12374956-12374978 TCTTGCACAGGGGCTGCAGGTGG + Intergenic
1201422981 Y:13820152-13820174 TCTCGCACAGGGGCTGCAGGTGG + Intergenic
1201468401 Y:14309657-14309679 TCCCACACTGGGGCCGCAGGTGG - Intergenic
1201469165 Y:14314864-14314886 TCCCGCACTGGGGCTGCAGGTGG - Intergenic
1201480003 Y:14428504-14428526 TCCCGCACCGGGGCTGCAGGTGG - Intergenic
1201487134 Y:14506064-14506086 TCCAGCACCAGGGCTGCAGGTGG - Intergenic
1201488224 Y:14513227-14513249 TCCAGCACCGGGGCTGCAGGTGG - Intergenic
1201495628 Y:14589730-14589752 TCCCACACCGAGGCTGCAGGTGG + Intronic
1201496870 Y:14598144-14598166 TCCCGCACTGGGGCTACACGTGG + Intronic
1201715676 Y:17042438-17042460 TCCTGTACAGGGCATGCAGGAGG + Intergenic
1201715876 Y:17043527-17043549 TCCCTCACCGGGGCTGCAGGTGG - Intergenic
1201982554 Y:19923664-19923686 TCCCGCACCAGGGCTGCAGGTGG + Intergenic
1202109906 Y:21407615-21407637 TCGCGCACTGGGGCTGCAGGTGG - Intergenic
1202137023 Y:21676610-21676632 TCCCGCACCGGGGCTGCAGGTGG + Intergenic
1202235828 Y:22708924-22708946 TCCCACACCGGGGCTGCAGGTGG - Intergenic
1202307335 Y:23487244-23487266 TCCCACACCGGGGCTGCAGGTGG + Intergenic
1202563470 Y:26183342-26183364 TCCCACACCGGGGCTGCAGGTGG - Intergenic