ID: 985403797

View in Genome Browser
Species Human (GRCh38)
Location 4:189616594-189616616
Sequence CTCCACCTGCAGCCCCTGTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1651
Summary {0: 44, 1: 422, 2: 402, 3: 280, 4: 503}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985403797_985403799 0 Left 985403797 4:189616594-189616616 CCGCACAGGGGCTGCAGGTGGAG 0: 44
1: 422
2: 402
3: 280
4: 503
Right 985403799 4:189616617-189616639 CTGCCTGCCAGTCCCGCGCCGGG No data
985403797_985403798 -1 Left 985403797 4:189616594-189616616 CCGCACAGGGGCTGCAGGTGGAG 0: 44
1: 422
2: 402
3: 280
4: 503
Right 985403798 4:189616616-189616638 GCTGCCTGCCAGTCCCGCGCCGG No data
985403797_985403806 24 Left 985403797 4:189616594-189616616 CCGCACAGGGGCTGCAGGTGGAG 0: 44
1: 422
2: 402
3: 280
4: 503
Right 985403806 4:189616641-189616663 GCCTGCACTCCTCAGCCCTTGGG 0: 223
1: 611
2: 703
3: 523
4: 731
985403797_985403805 23 Left 985403797 4:189616594-189616616 CCGCACAGGGGCTGCAGGTGGAG 0: 44
1: 422
2: 402
3: 280
4: 503
Right 985403805 4:189616640-189616662 AGCCTGCACTCCTCAGCCCTTGG No data
985403797_985403808 27 Left 985403797 4:189616594-189616616 CCGCACAGGGGCTGCAGGTGGAG 0: 44
1: 422
2: 402
3: 280
4: 503
Right 985403808 4:189616644-189616666 TGCACTCCTCAGCCCTTGGGTGG 0: 266
1: 706
2: 685
3: 253
4: 258

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985403797 Original CRISPR CTCCACCTGCAGCCCCTGTG CGG (reversed) Intergenic
900113200 1:1018261-1018283 CTCCACTTGCAGCCCCAGTGCGG - Intergenic
900123658 1:1059933-1059955 CTCCACCCGCAGGCCCTGCCAGG + Intergenic
900144121 1:1150591-1150613 ATCCCCCTGCAGCCCCTGTGAGG - Intergenic
900145896 1:1158534-1158556 CACCAAGTGCAGCCACTGTGCGG + Intergenic
900193576 1:1362133-1362155 CTCCTCCTGCAGCCCCGAGGAGG + Intergenic
900344155 1:2203214-2203236 CTTCGCCTGCAGCCCAGGTGGGG + Intronic
900361212 1:2289919-2289941 CGCCTCCTGCACCCCCTCTGTGG - Intronic
900400443 1:2470846-2470868 CTCCCTCTGCAGCTCCTCTGGGG + Intronic
900551617 1:3259273-3259295 CCCCAGCTGCAGCCCCTGGAGGG - Intronic
900580422 1:3405894-3405916 GCCCCCCTCCAGCCCCTGTGAGG - Intronic
900840104 1:5041853-5041875 CTCCATCTCCAGGCCCTCTGTGG + Intergenic
901045913 1:6395723-6395745 CTCCACCTGCAGCCCCAGTGCGG - Intergenic
901768416 1:11518289-11518311 CTCTCCCTCCAGCCCCTCTGGGG - Intronic
901783414 1:11609127-11609149 CTCCACCTGCAGCCCCGGTGTGG + Intergenic
902032547 1:13433796-13433818 CTCCACCTGCGGCCCCGGTGTGG - Intergenic
902033516 1:13439658-13439680 CTCCACCTGCGGCCCCGGTAGGG + Intergenic
902456024 1:16534693-16534715 CTCCACCTGCTGTCCTTGTTGGG + Intergenic
902496142 1:16873218-16873240 CTCCACCTGCTGTCCTTGTTGGG - Intronic
903351198 1:22717467-22717489 CCCCTGCTGCAGCCCCTGTGGGG + Intronic
903438746 1:23371291-23371313 CTGCATCTGGAGCCCCTGGGGGG + Exonic
903657265 1:24956993-24957015 CAGCACATGCAGTCCCTGTGGGG - Intronic
904238819 1:29131093-29131115 CTCAACCTGTGGCCCCGGTGTGG - Intergenic
904365820 1:30010403-30010425 CTCTATCTGCAGCCACTGTTTGG + Intergenic
905185969 1:36197074-36197096 CTCCACCTGCAGCCCTGGCGCGG + Intergenic
905375702 1:37518663-37518685 CTCCACCTGCAGCCCCGGTGCGG + Intergenic
906608603 1:47187461-47187483 CTGCACATGCAGCCCCACTGTGG - Intronic
906813156 1:48850062-48850084 CTCTCCCAGCAGCCCCTGTCTGG + Intronic
906877640 1:49556657-49556679 CTCCGCCTGCGGCCCCTGCGCGG - Intronic
907408779 1:54270358-54270380 CTCCCCCGGCAGCTCCTGTGCGG + Intronic
907515553 1:54991190-54991212 CTCTGCCTCAAGCCCCTGTGGGG + Intronic
907931041 1:59000474-59000496 CTCCTCCAGCTGCCCCAGTGAGG + Intergenic
907980124 1:59472496-59472518 CTCCACCTGCAGCCCCGGTGCGG + Intronic
908027679 1:59969613-59969635 CTCCACCTGCAGCCCCGGTGCGG - Intergenic
908291413 1:62670301-62670323 CTCCACCTGCAGCCCTGGTGCGG + Intronic
908462232 1:64356992-64357014 CTCCAACTGCAGCCCCCAAGAGG - Intergenic
909317955 1:74247849-74247871 CTCCGCCTGCGGCCCCTGCGTGG - Intronic
909318473 1:74253286-74253308 CTCCACCTGCGGCCCCTGTGCGG - Intronic
910034696 1:82776731-82776753 TTCCACCTGCAGCCCTGGTGCGG - Intergenic
910478757 1:87636178-87636200 CTCCACCTGTGGCCCTGGTGCGG - Intergenic
910609682 1:89127990-89128012 CTCCACCTGCAGCCCCTGTGCGG - Intronic
911001517 1:93170640-93170662 CTCCACCTGCGGCCCAGGTGCGG + Intronic
911259525 1:95669577-95669599 CTCCACCTGCAGCACCGGTGTGG - Intergenic
911305161 1:96224287-96224309 CTCCACCTGCAGCCCCAGCGTGG - Intergenic
911839171 1:102659959-102659981 CTCCACCTGCAGACCGGGCGCGG - Intergenic
911954428 1:104217393-104217415 CTCCACCTGCAGCCCCAGTGCGG - Intergenic
912058052 1:105631184-105631206 CTCCACTTGCAGCCTTGGTGCGG - Intergenic
912166231 1:107045179-107045201 CTCCACCTGCAGCCCAGGTGTGG + Intergenic
912312804 1:108640818-108640840 CTCCACCTGCAGCCCCGGTGCGG - Intronic
912365985 1:109134342-109134364 CTCCACCTGGAGAACCTATGAGG - Intronic
912698948 1:111861830-111861852 CGCCTCCAGCAGCCTCTGTGGGG + Intronic
912706770 1:111920589-111920611 GGGCAGCTGCAGCCCCTGTGGGG + Intronic
912819301 1:112854462-112854484 CTCCACCTGCAGCCCCGTGCGGG - Intergenic
913160995 1:116146503-116146525 CTCCACCTGCAGCCCCAGTGCGG - Intergenic
913469071 1:119171916-119171938 CTCCACCTGCGGCCCCGGTGCGG + Intergenic
913556187 1:119969547-119969569 CTCCACCTGCATCGACCGTGTGG - Exonic
913692043 1:121289053-121289075 CTCCACCTGCAGCCCCGGTGCGG - Intronic
914145515 1:144991061-144991083 CTCCACCTGCAGCCCCGGTGCGG + Intronic
914438364 1:147680715-147680737 CTCCACCTGCAGCCCTGGTGCGG - Intergenic
914490920 1:148149632-148149654 GTCCACATGCAGCCCCTGGGTGG - Intronic
915260136 1:154671173-154671195 CTCCACCTGCAGCCCTGATGTGG + Intergenic
915261306 1:154678460-154678482 CTCCACCTGCAGCCCTGATGTGG + Intergenic
915736920 1:158090901-158090923 CTCCCCATCAAGCCCCTGTGTGG - Intronic
915767092 1:158374105-158374127 CTGCACCTGCAGCCCAGGTGCGG - Intergenic
915865477 1:159494557-159494579 CTCCATCTGCAGCCCTGGTGCGG - Intergenic
915929236 1:160048504-160048526 CTGCACCTGCTGCCCCTGGGAGG - Intronic
916075536 1:161198128-161198150 CTCCACCTCCAGCCCCTGGAGGG - Exonic
916910039 1:169337023-169337045 CTCCACCTGCAGCCCCGGTGCGG - Intronic
916939097 1:169661584-169661606 CTCCACCTGCAGCCCTGGTGTGG + Intergenic
916940135 1:169668422-169668444 CTCCACCAGCAGCCCCGGCGTGG + Intronic
916960356 1:169882522-169882544 CTCCACCTGCAGCCCCAGTGCGG + Intronic
916991543 1:170250670-170250692 CTCCGCCTGGGGCCCCTGCGTGG - Intergenic
917348796 1:174056358-174056380 CTCCACCTACAGCCCCAGTGCGG - Intergenic
917445341 1:175102249-175102271 CTCCACCTGCAGCCCCAGTGCGG - Intronic
917446296 1:175108406-175108428 CTCCACCTGCAGCCCCAGTGCGG - Intronic
917932914 1:179836846-179836868 CTCCACCTGCGGCCCCGGTGGGG - Intergenic
918059083 1:181046240-181046262 CTCCACCTGCAGCCCCAGTGGGG + Intronic
918659692 1:187073765-187073787 CTCCACCTGCAGCCCCCGTGCGG - Intergenic
918709015 1:187704031-187704053 CTCCACCTGCAGCCCCGGTGCGG + Intergenic
918720905 1:187850613-187850635 CTCCACCTGCAGCCCCTGTGCGG + Intergenic
918790042 1:188813430-188813452 CTCTACCTGCGGCCCCAGTGCGG + Intergenic
918853140 1:189718248-189718270 CTCCACCGGCAGCCCTCGTGCGG - Intergenic
918952066 1:191151793-191151815 CTCCACCTGCAGCCCCGGTGCGG + Intergenic
919091977 1:192987320-192987342 CTCCACCCGCAGCCCTGGTGTGG + Intergenic
919167882 1:193918861-193918883 TTCCACCTGCAGCGCTGGTGCGG - Intergenic
919174542 1:194002250-194002272 CTCCACCTGCAGCCCTGGTGCGG + Intergenic
919201279 1:194358218-194358240 GTCCACCTGCAGCCCTGGTGTGG - Intergenic
919223819 1:194667110-194667132 TCCCACCTGCAGCCCATGGGCGG - Intergenic
919237089 1:194859411-194859433 CTCCACCTGCAGCACCGGTGCGG + Intergenic
919250901 1:195054689-195054711 CTCCACCTGCAGCCCCAGTAAGG + Intergenic
919419700 1:197355344-197355366 CTCCACCTGCGGCCCCTGCGTGG - Intronic
919493444 1:198234732-198234754 CTCCTGCTGCTGCTCCTGTGTGG + Intronic
919631016 1:199960031-199960053 CTCCACCTGCGGCCCCAGTGCGG + Intergenic
920150304 1:203900650-203900672 CTCCACCTGTGGCCCCAGTGGGG + Intergenic
920194041 1:204214138-204214160 CTCCACCTGCCGCGCCTGCCCGG + Intergenic
920479364 1:206307401-206307423 CTCCACCTGCAGCCCCGGTGCGG - Intronic
920731299 1:208488387-208488409 CTCCACCTGCAGCCCCAGTGTGG - Intergenic
920756756 1:208740089-208740111 CTCCACCAGCAGCCCCGGTGCGG + Intergenic
920878385 1:209858598-209858620 CTCCACCTGCGGCCCCGCTGCGG - Intergenic
920881954 1:209888897-209888919 CTCCACCTGCAGCCCGGGTGCGG - Intergenic
920883080 1:209898750-209898772 GTCCACCTGCAGCCCCGGTGCGG - Intergenic
920955686 1:210618620-210618642 CCCCACATGCAGCCCCTCTGTGG + Intronic
921094333 1:211874213-211874235 CTCCACCTGTGGCCCCTGTGCGG - Intergenic
921389619 1:214605590-214605612 GTCCACATGCAGCCCCTGGGGGG + Intronic
921396306 1:214673096-214673118 CTCCACCTGCAGCCCGGGTGCGG - Intergenic
921692116 1:218164337-218164359 CTCAACCTGCATCCCCTTAGCGG - Intergenic
921897165 1:220412843-220412865 CTCCACCTGCAGCCCCGGTGCGG + Intergenic
921983601 1:221285607-221285629 CTCCAACTGCAGTCCTGGTGCGG - Intergenic
922046043 1:221946944-221946966 TTCCACCTGCAGCAGCAGTGTGG - Intergenic
922056897 1:222050157-222050179 CTCCACCTGCAGCCCCTGTGCGG + Intergenic
922251865 1:223856577-223856599 CTCCTCCAGCTGCCCCAGTGAGG - Intergenic
922423284 1:225473118-225473140 CTCCACCTGCAGCCCCGGTGCGG + Intergenic
922485498 1:225970177-225970199 CTCCATCTGCAGCACCAGTGCGG + Intergenic
922699519 1:227750650-227750672 CTCCCCCTGCAGACACTGTCAGG - Intronic
922855865 1:228774115-228774137 CTCCACCTGCAGCCCCGGTGCGG + Intergenic
922985949 1:229865867-229865889 CTCCACCCGCAGCCCTGGTGCGG + Intergenic
923172534 1:231430768-231430790 CTCCACCTGCGGCCCCAGTGCGG - Intergenic
923193385 1:231641898-231641920 CTCCACCTGTAGCCCCGGTGCGG - Intronic
923324741 1:232871393-232871415 CTCCACCTGCAGCCCCGGTGCGG - Intergenic
923353256 1:233129531-233129553 CTCCACCTGCGGCCTCAGTGTGG + Intronic
923810449 1:237309579-237309601 CTCCGCCTGCGGCCCTTGTGTGG - Intronic
923930007 1:238684581-238684603 CTCCACCTGCAGCCCCTGTGGGG - Intergenic
924117596 1:240762899-240762921 CTCCACCTGCAGCCCCGGTGCGG + Intergenic
924440553 1:244082154-244082176 GCCCAGCTGGAGCCCCTGTGAGG + Intergenic
1063148874 10:3319763-3319785 CTCCACCTGCAGCCCAGGTGTGG - Intergenic
1063309243 10:4937376-4937398 CTCCACCTGCGGCCCTGGTGCGG - Intronic
1063318651 10:5032468-5032490 CTCCACCTGCAGCCCCGGTGCGG - Intronic
1063322125 10:5060636-5060658 CTCCACCTGCAGCCCCAGTGTGG - Intronic
1063377433 10:5562413-5562435 CTGCTCCTGGAGCCCCAGTGAGG + Intergenic
1063769771 10:9183761-9183783 CTCCACCTGCAGCCCTGGTGCGG + Intergenic
1064449135 10:15426048-15426070 CTCCACCTGCGCCCTCGGTGAGG - Intergenic
1064461101 10:15535348-15535370 CTCCACCTGCGGCGCCGGTGCGG + Intronic
1064713586 10:18152126-18152148 GTCCACCTGCAGCATCGGTGGGG + Intronic
1064790288 10:18951228-18951250 CTCCACCTGCAGCCCTGGTGTGG - Intergenic
1065441410 10:25756409-25756431 CTCCACCTGCAGCCCCGGTACGG + Intergenic
1065743207 10:28815623-28815645 CTCCACCTGCAGCCCCTGTGCGG - Intergenic
1065752104 10:28896769-28896791 CCCCATCTGCAGCTCCGGTGCGG - Intergenic
1065802678 10:29366590-29366612 CTCCACCTGCAGCCCTGGTGTGG + Intergenic
1065895956 10:30163223-30163245 CTCCACCTGCAGCCCCTGTGCGG + Intergenic
1065983779 10:30930012-30930034 CTCCACCTGCGGCCCTGGCGAGG - Intronic
1066186375 10:33013703-33013725 CTTCACTTGCAGCCCCAGTGCGG + Intergenic
1066190340 10:33049637-33049659 CTCCACCTGCAGCCCCGGTGCGG + Intergenic
1066234119 10:33468444-33468466 CTCCACCTACAGCCCCGGTGTGG + Intergenic
1066235383 10:33480417-33480439 CTCCACCTGCAGCCCCGGTGTGG - Intergenic
1066296168 10:34055926-34055948 CTCCACCTGCAGCCCCCGTGCGG + Intergenic
1066567327 10:36734568-36734590 CTCCACCTGCAGCCCCAGTGCGG - Intergenic
1066614995 10:37285117-37285139 CTCCGCCCGCAGCCCTGGTGTGG - Intronic
1066660950 10:37737740-37737762 CTCCACCTGTGGCCCCCGTGCGG + Intergenic
1067047337 10:42991979-42992001 CACCACCTGCAGCACCAGAGTGG + Intergenic
1067285337 10:44903695-44903717 CTCCCCCTGCAGCACATATGGGG - Intergenic
1067363267 10:45601152-45601174 CTCCACCTGCAGCCCTGGTGTGG + Intergenic
1068216754 10:53991223-53991245 CTCTGCCTGCAGCCCCGGCGTGG + Intronic
1068374096 10:56155535-56155557 CTCCACCTGCAGCCCTGGTGCGG + Intergenic
1068455603 10:57250251-57250273 CTCCACCTGCAGCCCCAGGGCGG + Intergenic
1068460433 10:57321887-57321909 CTCCACCTGCAGCCCCTGGGCGG + Intergenic
1068792344 10:61041025-61041047 CTCCACCTGCAGCCCTGGTGCGG + Intergenic
1068902189 10:62280789-62280811 CTCCACCTGCAGCCCTGGTGTGG + Intergenic
1068978213 10:63034000-63034022 CTCCACCTGCAGCCCCGGTGCGG + Intergenic
1069186448 10:65429357-65429379 CTCCACCTGCAGCCCCTGTGCGG - Intergenic
1069534099 10:69240568-69240590 CACTACCTGCTGCCTCTGTGGGG + Intronic
1069766218 10:70862072-70862094 CTCCACCCGCAGCCCCGGTGCGG + Intronic
1069988754 10:72301014-72301036 CTCTACCTGCGGCCCTGGTGCGG + Intergenic
1070264156 10:74886391-74886413 CCCCACCTGCATCCCAGGTGAGG + Intronic
1070564020 10:77590230-77590252 CTCCACCTGCGGCCCCGGTGCGG - Intronic
1070604347 10:77888334-77888356 CCTCTCCTGCAGCCCCTGCGTGG + Intronic
1070739949 10:78896347-78896369 CTCCAGCCGCTGCCCCTGTCTGG + Intergenic
1070774344 10:79101071-79101093 CACACCCTGCAGCCCCTCTGTGG - Intronic
1070937955 10:80315812-80315834 CTCCACCTGTGGCCCCAGTGCGG + Intergenic
1070942495 10:80359446-80359468 CTCCGCCTGCAGCCCTGATGCGG - Intronic
1070968378 10:80543625-80543647 CTCCACCTGCAGCCCCAGTGCGG + Intronic
1070999213 10:80814565-80814587 CTCCACCTGTGGCCCTGGTGCGG + Intergenic
1071003831 10:80859665-80859687 CTCCACCTGCAGCCCCGGTGCGG + Intergenic
1071041015 10:81309024-81309046 CTCCACCTGCAGTCCCGGTGCGG - Intergenic
1071388074 10:85141811-85141833 CTCCACCTGCAGCCCTTGTGCGG + Intergenic
1071900936 10:90119779-90119801 CTCCACCTGCAGCCCCGGTGTGG - Intergenic
1072205869 10:93204917-93204939 CTCCACCTCCTCCCACTGTGAGG + Intergenic
1072278556 10:93845564-93845586 CTCCACCTGCAGCCCCAGTGTGG + Intergenic
1072549782 10:96468758-96468780 CTCCACCTGGGGCCACGGTGGGG - Intronic
1072633076 10:97160125-97160147 CTCCACCTGCAGACCCGCTGAGG + Intronic
1072996448 10:100249055-100249077 CTCCTCCAGCTGCCCCTGAGGGG + Intronic
1073010945 10:100359135-100359157 CCCCACCTCCAGCCTCTGGGTGG + Intronic
1073297858 10:102451659-102451681 ATCCACCTGCAGGCGCTGGGAGG - Intergenic
1073789699 10:106928054-106928076 CTCCACATGCAGCGCCGGTGCGG - Intronic
1074098208 10:110331877-110331899 CTCCACCTGCGGCCCCAGTGCGG + Intergenic
1074174978 10:110990174-110990196 CTCCACCTGCAGCCCTGGTGCGG + Intronic
1074192613 10:111150744-111150766 CTACTCCTGCAGCCCCTGGGTGG + Intergenic
1074317357 10:112371627-112371649 CTCCACCTGTGGCCACGGTGCGG + Intergenic
1074999303 10:118783314-118783336 CTCCACCTGCAGCCCCGGTGCGG + Intergenic
1075255697 10:120924236-120924258 CTCCACCTGCAGCCCCTTTGCGG + Intergenic
1075269309 10:121035288-121035310 CTCTACCTGCAGCCCCAGTGTGG - Intergenic
1075305780 10:121365941-121365963 CTCCACCTGCAGCCCCAGTGCGG + Intergenic
1075307690 10:121382530-121382552 CTCCACCTGCAGCCCCAGTGCGG + Intergenic
1075442794 10:122493218-122493240 GTCCACCTGCAGCCCCGGCCAGG + Intronic
1075537447 10:123283303-123283325 CTCCACCTGCAGCCCCTTTGCGG - Intergenic
1075731083 10:124637232-124637254 TGCCACCTGCGGACCCTGTGAGG - Intronic
1076261582 10:129071301-129071323 CTCCACCTGCAGCCCCGGTGCGG - Intergenic
1076406556 10:130215865-130215887 CACCACCTCCAGGGCCTGTGGGG - Intergenic
1076413401 10:130267542-130267564 CTCCACCTTCAGGTCCTCTGAGG + Intergenic
1076679471 10:132164232-132164254 CTCCAACCACAGCCCCTCTGAGG - Intronic
1076773686 10:132681065-132681087 CTCCACCTGCAGCCCCAGTGCGG + Intronic
1076796462 10:132800894-132800916 CTCCACCTGCAGCCCCAGTGCGG - Intergenic
1076983180 11:216126-216148 CAACACCTGCAGTCCCTTTGAGG + Exonic
1077197692 11:1289454-1289476 CTGCACCTGCAGCGCTTCTGAGG - Intronic
1077259448 11:1608070-1608092 CTCCAGCTGTGGCTCCTGTGGGG - Exonic
1077259485 11:1608202-1608224 CTCCAGCTGTGGCTCCTGTGGGG - Exonic
1077261198 11:1621868-1621890 CTCCAGCTGTGGCTCCTGTGGGG - Exonic
1077303325 11:1856937-1856959 CTCCCTCAGCAGCCCCTGTGGGG - Intronic
1077347752 11:2071929-2071951 TTCCACCCCCAGCCGCTGTGTGG - Intergenic
1077442305 11:2574451-2574473 CCCCACCTCCAGCCCCCGTGCGG - Intronic
1077556324 11:3227822-3227844 CCCCAGCTGCAGCCCCCGTGAGG - Exonic
1077583727 11:3434934-3434956 CTCCACTTGCGGCCCTGGTGTGG - Intergenic
1077603301 11:3589091-3589113 CTCCACCTGCAGCTCTTGTGCGG + Intergenic
1077764667 11:5144807-5144829 CTCCACCTGCAGCCCCGGTGTGG + Intergenic
1077778146 11:5294392-5294414 CTCCCCCTGCAGCCCAGGTGCGG - Intronic
1077805838 11:5590290-5590312 CTCCACCTGCAGCCCCTGTGTGG + Intronic
1078246065 11:9574014-9574036 CTCGCCCTGCAGCGACTGTGAGG + Exonic
1078251829 11:9622984-9623006 CTCCACCTGCAGCCCCGGTGCGG - Intergenic
1078301127 11:10133253-10133275 CTCCACCTGCAGCCCCTACGCGG - Intronic
1078743619 11:14091276-14091298 CTCCACCTGCAGCCCCGGTGCGG - Intronic
1078795895 11:14591476-14591498 TTCCACCTGCAGCCCCAGTGTGG + Intronic
1078891416 11:15561334-15561356 CTCCACCTGCGGCCCCGGTGCGG + Intergenic
1079079303 11:17402823-17402845 CTCCACCTGCTACCGCTGTGTGG + Intronic
1079108749 11:17591495-17591517 CTCCACCTGCACTGCCTATGGGG + Exonic
1079190912 11:18276085-18276107 CTCCACCTGTGGCCCCGGTGCGG - Intergenic
1079555352 11:21753091-21753113 CTCCACCTGCAGCCCCCGTGCGG - Intergenic
1079726149 11:23883380-23883402 CTCCACCTGCAGCCCTGGTGCGG - Intergenic
1079767698 11:24415950-24415972 CTCCATCTGCAGCCCCAGTGTGG - Intergenic
1080105955 11:28512282-28512304 CTCCACCTGCTGCCCCGGTGCGG - Intergenic
1080107429 11:28525746-28525768 CTCCACCTGCGGCCCCGGTGCGG - Intergenic
1080138900 11:28891028-28891050 CTCCACCTGCGGCCCCAGTGCGG + Intergenic
1080317865 11:30970640-30970662 CTCCACCTGCAGCCACCATCTGG + Intronic
1080557621 11:33431692-33431714 CTCCACCTGCAGCCCCGGTGCGG - Intergenic
1080621520 11:33990510-33990532 CTCCACCTGCAGCCCCGGTGCGG + Intergenic
1081125133 11:39312243-39312265 CTCCACCTGCAGCCCCGGTGCGG + Intergenic
1081160871 11:39746543-39746565 CTCCATATGCAACCCCTGTGGGG - Intergenic
1081315268 11:41623248-41623270 CTGCACCTGCAGCCCCAGTGCGG + Intergenic
1081422140 11:42881794-42881816 CTCCACCTGCAGCCCCAGTGCGG + Intergenic
1081428458 11:42950297-42950319 CTCCACCTGCAGCCCTCGTGCGG + Intergenic
1081713799 11:45234415-45234437 CTCCACCTGCAGCCCAGGGCGGG + Intronic
1081850768 11:46273833-46273855 CTCCATGTCCAGCCCCAGTGGGG + Intergenic
1082270376 11:50163996-50164018 CTCCACCTGCAGCCCCAGTACGG - Intergenic
1082272191 11:50183685-50183707 CTCCACCTGCAGCCCCAGGGCGG + Intergenic
1082734988 11:56845602-56845624 CTCCACCTGCAGCCCCCTGTGGG + Intergenic
1083074226 11:60020206-60020228 CTCCACCTGCAGCCCCGGTATGG - Intergenic
1083417186 11:62533400-62533422 CTGCACCTGAAGTCTCTGTGGGG - Exonic
1083722819 11:64611807-64611829 CTGCATCTGCAGCTCCTCTGGGG + Intronic
1084024677 11:66440727-66440749 CTCCACCTGTAGCCCGGGTGCGG - Intronic
1084107484 11:66989204-66989226 CTCCACCTGCAGCCCCGGTGCGG + Intergenic
1084320504 11:68370802-68370824 GTCCACATGCAGCCAGTGTGGGG + Intronic
1084556927 11:69880997-69881019 CCCCACCACCCGCCCCTGTGGGG + Intergenic
1084798787 11:71527462-71527484 CTCCAGCTGTGGCTCCTGTGGGG + Exonic
1084800118 11:71538196-71538218 CTCCAGCTGTGGCTCCTGTGGGG + Exonic
1084803891 11:71565770-71565792 CTCCAGCTGTGGCTCCTGTGGGG + Exonic
1084806475 11:71582654-71582676 CTCCAGCTGTGGCTCCTGTGGGG - Exonic
1084813575 11:71631545-71631567 CTCCACTTGCAGCTCCTGTGCGG - Intergenic
1084941728 11:72616749-72616771 CTCCACGTGCAGACCGGGTGGGG + Intronic
1085245676 11:75098619-75098641 CTCCACCTGCAGCCCCGGTGCGG + Intergenic
1085298026 11:75441864-75441886 CTCCTCCTAGAGCACCTGTGGGG + Intronic
1085375960 11:76060976-76060998 CTCCACCTGCGGCCCTGGTGCGG + Intronic
1085408462 11:76277861-76277883 CACCACCCGCAGCCCCTCTCTGG + Intergenic
1085510000 11:77083356-77083378 CTCCACATGAGGCCCCAGTGAGG + Intronic
1085545113 11:77311080-77311102 CTCCACCTCCAATCTCTGTGTGG + Intergenic
1085671021 11:78464919-78464941 GTCCACCTGCAGCCCCAGTGTGG - Intronic
1085982720 11:81744465-81744487 CTTCACCTGCGGCCCTGGTGGGG - Intergenic
1086043104 11:82501569-82501591 CTCCACCTGCAGACCCGGTGCGG + Intergenic
1086210047 11:84308499-84308521 CTCCACCTGTGGCCCCCGTGCGG - Intronic
1086397676 11:86433472-86433494 CTCCACCTGCGGCCCCGGTGCGG - Intergenic
1086724700 11:90167553-90167575 CTCCACCTGTGGCCCCGGTGTGG + Intronic
1087354610 11:97077011-97077033 CTCCACCTGCAGCCCTGGTGCGG + Intergenic
1087486315 11:98763357-98763379 CTCCACCTGCAGCCCCGGTGCGG - Intergenic
1087683733 11:101241195-101241217 CTCCACCTGCGGCCCTGGTGCGG - Intergenic
1088570948 11:111222388-111222410 CTCCACCTGCAGCCCTGGTGCGG + Intergenic
1088837233 11:113588049-113588071 CACCACCTGCATCCCATCTGAGG - Intergenic
1089373497 11:117978436-117978458 CTCCACCTGAAGCCCCGGTGCGG - Intergenic
1089422793 11:118344230-118344252 CTGCACCTGCAGCCCTGCTGAGG + Intergenic
1089466329 11:118688925-118688947 CTCTACCTGCAGCCGGGGTGCGG - Intergenic
1089574949 11:119435429-119435451 CTCCACATGCAGCCCCTTGTGGG - Intergenic
1089800317 11:121022071-121022093 CTCCACCTGCAGCCCCGGTGCGG + Intergenic
1090229300 11:125089908-125089930 CTCCACCTGCAGCCCCGGTGCGG + Intronic
1090307609 11:125704651-125704673 CTCCACCTGCAGCCCCGGTGCGG - Intergenic
1090588317 11:128237456-128237478 CTCCACCTGCAGCCCATTGCGGG + Intergenic
1090776651 11:129971781-129971803 CTCCACCTGCAGCCCCGGTGCGG - Intronic
1090987331 11:131780251-131780273 CTGCACCTGCTGTCCCTGCGTGG - Intronic
1090998096 11:131885259-131885281 CTCCAGCTGGAAGCCCTGTGAGG - Intronic
1091104863 11:132909109-132909131 CTTCAGCTGCAGCCCTTGGGAGG + Intronic
1091143910 11:133260476-133260498 CTCCACCTTCAACACCTTTGAGG - Intronic
1091201277 11:133782710-133782732 CTCCACCTGCGGCCCCGGTTTGG + Intergenic
1091233376 11:134002837-134002859 CTCCACCTGCAGCCCCGGTGCGG - Intergenic
1091402177 12:188066-188088 CTCCACCTGTGGCCCCAGTGAGG - Intergenic
1091402529 12:189535-189557 TTTCTCCTGCAGCCCCTGGGCGG + Intergenic
1091900873 12:4142919-4142941 CTCCACCTGGAGGACCTGGGTGG + Intergenic
1092101631 12:5888844-5888866 CTCCACCTGCGGCCCCAGTGTGG - Intronic
1092133994 12:6132892-6132914 CTCCACCTGCGGCCCCAGTGCGG + Intergenic
1092137501 12:6159886-6159908 CTCCACCTGCAGCCCAGGTGCGG + Intergenic
1092142034 12:6190820-6190842 CTCCACCTGCAGCGCTGGTGCGG - Intergenic
1092220359 12:6708693-6708715 CTCCACCTGCAGCCCCAGCGTGG + Intergenic
1092221473 12:6716447-6716469 CTCCACCTGCAGTCTCGGTGCGG + Intergenic
1092272996 12:7037832-7037854 CTTCACCTGCAGCCCCGGTGCGG + Intronic
1092410861 12:8252140-8252162 CTCCACCTGCAGCCCCCATGTGG - Intergenic
1092430510 12:8404639-8404661 CTCCACCTGCGGCTCCTGTGCGG + Intergenic
1092471844 12:8787677-8787699 CTCCACCTGCAGCCCCGGTGCGG + Intergenic
1092473039 12:8795136-8795158 CTCCACCTGCAGCCCCGGTGCGG + Intergenic
1092572348 12:9739519-9739541 CTCTACCTGCAGCCCCGGTGTGG - Intergenic
1092583763 12:9876120-9876142 CTCCACCTGCAGCCCAGGTGCGG - Intergenic
1092617075 12:10225562-10225584 CTCCACCTGCAGCCCCGGTGTGG - Intergenic
1092732529 12:11547659-11547681 CTCCACCTGCAGCCCCGGTGGGG + Intergenic
1093034576 12:14320505-14320527 CTCCACCTGCAGCCCCATTGCGG + Intergenic
1093189477 12:16057786-16057808 CTCCACCTGCAGCCCTGGTGCGG + Intergenic
1093266348 12:17008035-17008057 CTCCACCTGTAGCCCCAGTGCGG + Intergenic
1093527019 12:20115179-20115201 CTCCACCTGCAGCCCCGGTGCGG - Intergenic
1093653834 12:21673956-21673978 TTCCACCTGCTGCCCAGGTGCGG - Intronic
1093793794 12:23286339-23286361 CTCCACCTGCAGCCCCGGTGCGG + Intergenic
1093970279 12:25369777-25369799 CTCCACCTGCAGCCCCTGTGCGG + Intergenic
1094338528 12:29386190-29386212 CTCCACCTGCAGCCCAGGTGCGG - Intergenic
1094409910 12:30157271-30157293 CTCCACCTGCAGCCCTGGTGCGG + Intergenic
1094448798 12:30562044-30562066 CTCCACCTGCAGCCCGGGTGCGG + Intergenic
1094589228 12:31805738-31805760 CTCCACCTGCAGCCACGGTGCGG - Intergenic
1094661357 12:32472703-32472725 CTCCACCTGCAGCCCCGGTGCGG + Intronic
1094666558 12:32526083-32526105 CTCCACCTGCAGCCCCGGTGCGG + Intronic
1094718123 12:33033880-33033902 CTCCACCTGCAGCCCCGGTGCGG - Intergenic
1094828571 12:34289512-34289534 CTATCCCAGCAGCCCCTGTGTGG - Intergenic
1094833941 12:34313512-34313534 CTCATCCAGTAGCCCCTGTGCGG - Intergenic
1095123163 12:38442360-38442382 CTCCACCTGCAGCCCTGGTGTGG + Intergenic
1095304209 12:40621023-40621045 CTCCACCTGCAGCCCCGGTGAGG + Intergenic
1095534034 12:43224691-43224713 CTCCACCTGCAGCCCCAGTGTGG + Intergenic
1095642453 12:44500799-44500821 CTCCACCTGTGGCCCTGGTGCGG + Intergenic
1095776774 12:46018428-46018450 CTCCACCTGCAGCCCCCGTGCGG + Intergenic
1095901616 12:47333792-47333814 CTCCACCTCCAGTCCTGGTGAGG + Intergenic
1095984915 12:47992993-47993015 TTCTACCTGCAGGCCCTTTGCGG + Intronic
1096278520 12:50231585-50231607 AGCCACCTGCAGCCTCTGTGGGG - Intronic
1096389332 12:51217285-51217307 CTGCCCCTGGAGCCCTTGTGGGG - Intronic
1096801896 12:54115883-54115905 CTAGACCGGGAGCCCCTGTGGGG + Intergenic
1097017848 12:56000094-56000116 CTCCACCTGCAGCACCAGTGCGG - Intronic
1097128866 12:56795788-56795810 CTCCACCTGCAGCCCCGGTGCGG - Intergenic
1098168144 12:67719181-67719203 CTCCACCTGCAGCCCCTGTGCGG - Intergenic
1098498683 12:71166149-71166171 CTCCACCTGCGGCTCCGGTGTGG - Intronic
1098588749 12:72185457-72185479 CTCCACCTGCAGCCCCTGTGCGG + Intronic
1098759315 12:74403359-74403381 CTCCACCTGCAGCCCCGGTGTGG + Intergenic
1099191468 12:79565365-79565387 CTCCACCTGTGGCCCCGGTGTGG + Intergenic
1099413640 12:82361364-82361386 CTCCACCTGCAGCCCCAACGTGG - Intronic
1099443892 12:82729134-82729156 CTCCACCTGTGGCCCCAGTGCGG + Intronic
1099523871 12:83696244-83696266 CTCCACCTGCAGCCCCAGTGAGG - Intergenic
1099716160 12:86296351-86296373 CTCCACCTGCAGCCCTGGTGTGG - Intronic
1100166548 12:91923857-91923879 CTCCACCTGCAACCCCGGTGTGG - Intergenic
1100392627 12:94157222-94157244 ATCCACCTGCAGCACCTGCTGGG - Intronic
1100521528 12:95379996-95380018 CTTCACCTGCAGCCCCGGTGCGG + Intronic
1100584766 12:95969545-95969567 CTCCACCTGCAGCCCCGGTGCGG + Intergenic
1100600709 12:96109273-96109295 CTCCACCTGCAGCCCCGGTGCGG + Intergenic
1100734561 12:97512734-97512756 CTCCACCTGCAGCCCCGGTGCGG - Intergenic
1101009066 12:100430713-100430735 CTCCACCTGCAGCCCCGGTGCGG + Intergenic
1101443144 12:104718586-104718608 TGCCACCTGCAGTCCCTTTGAGG + Intronic
1101461892 12:104905461-104905483 CTCCACCTGCAGCCCCGGTGCGG - Intronic
1102662889 12:114545085-114545107 TTCCACCTGCAGCACCTCGGAGG - Intergenic
1103086643 12:118066537-118066559 CTCCACCTGCACCCCTGGCGGGG - Exonic
1103146074 12:118597125-118597147 CTCCACCTGCAGCCCTGGTGCGG - Intergenic
1103459593 12:121093484-121093506 CTCCACCTGCGGCCCTCGTGCGG - Intergenic
1103497626 12:121374850-121374872 GTCCACCTGCAGCTCCTGTGCGG + Intronic
1103551979 12:121744504-121744526 CTACACCAGCAACCCCAGTGGGG - Intronic
1103783318 12:123414062-123414084 CTCCATCTGCAGCCCCGGTGCGG - Exonic
1103853360 12:123947372-123947394 CTCCACCTGCAGCCCCGGTGTGG + Intronic
1103925061 12:124419028-124419050 CTCCACCCGCCTCCTCTGTGTGG + Intronic
1104127491 12:125861677-125861699 CTGCACATGCAGCCGCTGCGGGG - Intergenic
1104159130 12:126161733-126161755 CTCCAGCTGCAGCCCCTTCAGGG - Intergenic
1104344570 12:127983796-127983818 CTCCACCTGCGGCCCTGGTGCGG + Intergenic
1104582713 12:130022466-130022488 CTCCACCTGCAGCCCCGGTGCGG + Intergenic
1104614444 12:130256603-130256625 CTCCACCTGCAACCCCAGTGCGG - Intergenic
1104647270 12:130505895-130505917 CTCCATCTGTAGCCTCTTTGGGG - Intronic
1104749315 12:131228223-131228245 CTCCACCTGCAGCCCCGGTGCGG + Intergenic
1104754093 12:131258286-131258308 CACCACCTGCAGCCTCACTGGGG - Intergenic
1104864016 12:131942091-131942113 CTGCTCCTGCAGCAGCTGTGTGG - Intronic
1104866177 12:131956060-131956082 CTCCGCCTTCAGCCCCTGTCAGG + Intronic
1105037824 12:132939165-132939187 CTCCACCTGCAGCCCCGGTGCGG + Intronic
1105426819 13:20301714-20301736 CTCCACCAGCAGCCCCTCCGCGG + Intergenic
1105605096 13:21920651-21920673 TTCCACCTGCTGCCCCAGTGCGG - Intergenic
1105722242 13:23127982-23128004 CTCCACCTGCAGCCCCAGTGCGG + Intergenic
1105845052 13:24286797-24286819 CTCCAGCAGCACCCCCAGTGAGG + Exonic
1106221251 13:27748262-27748284 CTCCACCTGCAGCCCCGGCGCGG - Intergenic
1106466352 13:30017729-30017751 CTCCCCCTGCAGCCCCTCCAAGG + Intergenic
1106600487 13:31183001-31183023 CTCCACCTGCAGCCCTGGTGAGG - Intergenic
1106616993 13:31339614-31339636 CTCCACCTGCAGCCCCAGTGTGG - Intergenic
1106643360 13:31608778-31608800 CTCCACCTGCAGCCCTGGTGCGG - Intergenic
1106811020 13:33358392-33358414 CTCCACCTGCAGCCCCGGTGTGG + Intergenic
1107259311 13:38472379-38472401 CTCCACCTGCAGCCCCAGTGCGG - Intergenic
1107590391 13:41898528-41898550 CTCCACCTGCAGCCCTGGTGCGG - Intronic
1107694754 13:42989433-42989455 TTCCTCCTGCAGCCCCAGTGTGG - Intronic
1107836189 13:44413986-44414008 CTCCACCTGCAGCCTCGGTGCGG + Intergenic
1108099109 13:46936004-46936026 CTCCACCTGCAGCCCTGGTGTGG - Intergenic
1108313328 13:49216506-49216528 CTCCACCTGTAACTCATGTGGGG - Intergenic
1108469386 13:50753256-50753278 CTCCACCTGCAGCCCTGGTGCGG - Intronic
1108643903 13:52408024-52408046 CTCCACTTGCAGCCCCGGTGCGG - Intergenic
1108686805 13:52826667-52826689 CTCCACCCACAGCCCTGGTGCGG + Intergenic
1108727944 13:53201779-53201801 CTCCACCTGCAGCCACACTATGG - Intergenic
1108751466 13:53452343-53452365 CTCCACCTGTAGCCCTGGTGCGG - Intergenic
1108851544 13:54737225-54737247 CTCCACCTGCAGCCCCAGTGCGG - Intergenic
1108856467 13:54799672-54799694 CTCCACCTGCAGCCCTGTGGGGG - Intergenic
1108858886 13:54829449-54829471 CTCCATCTGCAGCCCCGGTGCGG - Intergenic
1108996073 13:56735974-56735996 CTCCACCTGCAGCCCCTGTGCGG + Intergenic
1109110941 13:58318484-58318506 CTCCAGCTGCAGCCCCAGTGGGG - Intergenic
1109124647 13:58504220-58504242 CTCCACCTGCAGCCCTGGTGCGG - Intergenic
1109141119 13:58714494-58714516 CTCCACCTGCAGCCCCGGTGCGG + Intergenic
1109145464 13:58773695-58773717 CTCCACCTGCAGCCCCACTGCGG + Intergenic
1109159802 13:58958131-58958153 CTCCACCTGCAGCCCCGGTACGG - Intergenic
1109364702 13:61339571-61339593 CTCCCCCTGCAGCCCCAGTGAGG + Intergenic
1109441437 13:62379640-62379662 CTCCACCTGCAGCCCCGGTGCGG + Intergenic
1109741595 13:66561435-66561457 CTCCACCTGTGGCCCTGGTGTGG + Intronic
1109858876 13:68171331-68171353 CTCCACGTGCCGCCCGGGTGTGG + Intergenic
1110023999 13:70511860-70511882 CTCCACCTGCAGCTCTGGTGCGG - Intergenic
1110368945 13:74718799-74718821 CTCCACCTGCAGCCCCGGTGCGG + Intergenic
1110417549 13:75268860-75268882 CTCCACCTGCAGCCCCAGTATGG + Intergenic
1110609753 13:77475445-77475467 CTCCACATGCGGCCCCTGTGCGG - Intergenic
1110792332 13:79600107-79600129 CTCCACCTGCAGCCCCAGTGCGG - Intergenic
1110854124 13:80278602-80278624 CTCCACCTGCGGCCCCAGTGGGG - Intergenic
1110862208 13:80355948-80355970 CTCCACCTGCAGGCCCGGTGTGG + Intergenic
1110874290 13:80490506-80490528 CTCCACCTGCAGCCCCAGTGCGG - Intergenic
1110940220 13:81340720-81340742 CTCCACCGGTAGCCCCGGTGCGG - Intergenic
1111220991 13:85205336-85205358 CTCCACCCACAGCCCCGGAGCGG + Intergenic
1111556103 13:89883815-89883837 CTCCACCTGCAGGGCTGGTGCGG - Intergenic
1111591102 13:90349010-90349032 TTCCACCTGCAGCCCCCATGCGG + Intergenic
1111602793 13:90495183-90495205 CTCCACCTGCAGCCCCAGTGGGG + Intergenic
1111748398 13:92297077-92297099 CTCCACCTGCAGCCCCTGTGCGG + Intronic
1111841339 13:93454735-93454757 CTCCACCTGCAGCCCGGGTGCGG - Intronic
1112077676 13:95931386-95931408 CTCCCCCTGCGGCCCAGGTGTGG - Intronic
1112226581 13:97545696-97545718 CTCCACCTGCGGCCCCCATGTGG + Intergenic
1112518716 13:100077927-100077949 CTCCACCTGCAGCCCTGGTGTGG + Intergenic
1112533096 13:100223998-100224020 CTCCACCTGCAGCCCCGGTGCGG - Intronic
1112613173 13:100976107-100976129 CTCCACCTGCAGCCCCGGTGCGG + Intergenic
1112842758 13:103600350-103600372 TGCCACCTGCAGCCCTGGTGCGG + Intergenic
1113371880 13:109732618-109732640 CTCCACCTGCAGCCCCCGGGCGG - Intergenic
1113482613 13:110632978-110633000 CTCCACCTGCAGCCCTGGTGCGG - Intronic
1113506705 13:110821571-110821593 CTCCACCTGCAGCCTCGGTGTGG + Intergenic
1113538059 13:111083821-111083843 CTCCACCTGCAGCCCCGGTGCGG - Intergenic
1113539013 13:111092402-111092424 CCCCACCTGCCCCCTCTGTGAGG + Intergenic
1113669979 13:112170101-112170123 CCCCACCTGCACCCTCTGGGAGG + Intergenic
1113678124 13:112222128-112222150 CTCCACCTGCAGCCTCGGTGTGG + Intergenic
1113958302 13:114111254-114111276 CTCCGCCTGCAGCTCGTTTGTGG - Intronic
1113958322 13:114111406-114111428 CTCCGCCTGCAGCTCGTTTGTGG - Intronic
1113995035 14:16057768-16057790 CTCCCCCCGCAGGCCCTGTGTGG + Intergenic
1114593610 14:23892169-23892191 CTCCACCTGCAGCCCTGGTGGGG + Intergenic
1116452434 14:45080847-45080869 CTCCACCTGCAGCCCCAGAGCGG + Intergenic
1116624086 14:47242855-47242877 TTCCACCTGCAGCCCCGGTGTGG + Intronic
1117077940 14:52122656-52122678 CTCCACCTGCAGCCCTGGTGCGG + Intergenic
1117297634 14:54393851-54393873 CTCCATCTGCAGCCCCGGTGCGG + Intergenic
1117302588 14:54443463-54443485 CTCCACCTGCAGCCCCGGTGTGG + Intergenic
1117449883 14:55839878-55839900 CTCCACTTGCAGCCCTGGTGTGG + Intergenic
1117536683 14:56709376-56709398 CTCCAGCTGCAGCCAGAGTGTGG + Intronic
1117571855 14:57056565-57056587 CTCCACCTGCAGCCCCGGTGCGG - Intergenic
1118215299 14:63803213-63803235 CTCCACCTGCAGCCCCGGTGGGG - Intergenic
1118306383 14:64658539-64658561 CTCCACCTGTAGCCCCTGTGCGG + Intergenic
1118346804 14:64946961-64946983 CTCCACCTGTAGCCACAGTGTGG + Exonic
1118616273 14:67576412-67576434 TGCCACCTGCAGCCACTGTGAGG - Exonic
1118878990 14:69810307-69810329 CTCCTCCTGCTGTCCCTGGGTGG + Intergenic
1118932492 14:70255254-70255276 CTCCACCTGCGGCCCCTGTGCGG + Intergenic
1119027843 14:71167904-71167926 CTCCACCTGCGGCCCCAGTGCGG + Intergenic
1119038917 14:71254708-71254730 CTCCATCTGCAGCCCCGGTGTGG + Intergenic
1119303619 14:73590427-73590449 CTCCACCTGCGAACCCCGTGCGG - Intergenic
1119486852 14:74994560-74994582 CTCCACCTGCAGCCCCAGTGCGG + Intergenic
1119673372 14:76536699-76536721 CTCCACCTGCAGCCCCGGTGCGG - Intergenic
1119778950 14:77265663-77265685 CTCAGCCTGCAGCGACTGTGAGG - Exonic
1119947109 14:78706467-78706489 CCCCACTAGCAGCACCTGTGAGG - Intronic
1120331050 14:83092792-83092814 CTCCACCTACAGCACCGGTGCGG + Intergenic
1120439036 14:84512857-84512879 CTCCACCCGCAGCCCCGGTGTGG - Intergenic
1121008867 14:90508238-90508260 ATCCACGTGCAGCCTCTGTGTGG - Intergenic
1121584654 14:95054918-95054940 CTCCACCTCCACACCCTGTGGGG + Intergenic
1122493386 14:102135460-102135482 CTCCACCTGCAGCCCCGGTGCGG - Intronic
1122514608 14:102298100-102298122 CTCCACCTGCAGCCCTGGTGTGG + Intronic
1122775181 14:104113850-104113872 CTCCACCTGCAGCCCCTCATGGG - Exonic
1122786479 14:104166513-104166535 CCCCACCTGCAGCCGCTGCCGGG - Intronic
1122885269 14:104707836-104707858 CTGCACCTGCAGCCCCCCCGTGG + Exonic
1122889255 14:104724912-104724934 CACCACCTGCAGACCTTGCGGGG - Intronic
1122894753 14:104751473-104751495 CTCCACCTGCAGCCCCGGTGTGG - Intergenic
1122939764 14:104976076-104976098 CTGCACCTGCTGCCCCGGTGTGG - Intronic
1123058554 14:105584041-105584063 CACCACCTGCTCCCACTGTGGGG - Intergenic
1123082888 14:105704275-105704297 CACCACCTGCTCCCACTGTGGGG - Intergenic
1123164593 14:106314492-106314514 CTCCACCTGCACCTGCTCTGGGG + Intergenic
1123799214 15:23803325-23803347 CTCCATCTGCAGCCCAGGTGCGG + Intergenic
1123949060 15:25253142-25253164 CTCCACCTGCAGCCCCAGTGCGG - Intergenic
1123995479 15:25715378-25715400 CTTCACCTGCAGCCTGAGTGTGG + Intronic
1124028620 15:25989544-25989566 CTCAGCCTGCAGCCCCTAAGCGG - Intergenic
1124114778 15:26831128-26831150 CTCCATCTGCAGCCCTGGTGCGG - Intronic
1124198518 15:27656397-27656419 CTCCACCTGTGGCCCAGGTGTGG - Intergenic
1124290999 15:28454752-28454774 GTCCACATGCAGCCCCCGGGAGG + Intergenic
1124573200 15:30884168-30884190 CTCCACCTGCAGCCCCGGTGCGG + Intergenic
1125112288 15:36047364-36047386 CTCCACCTGCAGCCCCGGTGCGG + Intergenic
1125480219 15:40074722-40074744 CTCCACCTGCAGCCCCATTGCGG - Intergenic
1125518423 15:40335566-40335588 CTCCCCCTTCGGCCCCTCTGGGG + Exonic
1125609771 15:40962030-40962052 CTCCACCTGCAGCCCCGGTGCGG + Intergenic
1125633736 15:41169885-41169907 CCCCACCTCCAACCCCTGAGTGG - Intergenic
1125885480 15:43226537-43226559 CTCCACCTGCGGCCCCAGTGCGG - Intergenic
1126128156 15:45314509-45314531 CTCCACCTGCAGCCCCCATGCGG + Intergenic
1126639744 15:50812380-50812402 CTCCACCTGTGGCCCCGATGCGG + Intergenic
1127984855 15:64061297-64061319 CTCCACCTGCGGCCCTGGTGGGG + Intronic
1128091206 15:64920097-64920119 CTCCACCAGGAGCCTTTGTGAGG - Intronic
1128598499 15:68975618-68975640 CTCCACCTGCAGCCCCGGTGCGG - Intronic
1128669913 15:69567307-69567329 CTCCACCTGCAGCCCTGGTGCGG - Intergenic
1128678627 15:69629984-69630006 TCCCACCTGCAGCCCTTCTGAGG + Intergenic
1128813236 15:70587123-70587145 CTCCACCTGCAGCCCTGGTGCGG - Intergenic
1129014222 15:72451455-72451477 CTCCTCCAGCTGCCCCAGTGAGG + Intergenic
1129158193 15:73732134-73732156 CTCCACCTGTAGTCCCGGTGGGG - Intergenic
1129196993 15:73974120-73974142 TTCCACCTGCAGCCCCCGTGTGG + Intergenic
1129208703 15:74052911-74052933 CTCCACCTGCGGCCCCCGTGCGG + Intergenic
1129280322 15:74480293-74480315 CTCCACCTGCAGCGCAGGTGTGG - Intergenic
1129388114 15:75206952-75206974 CTCCCACTGCAGCCTCTGGGGGG + Exonic
1129605819 15:77024485-77024507 CTCTCCCTGCAGCCTCTCTGTGG - Intronic
1129777431 15:78246086-78246108 CTCCACCTGCAGCCCGGGTGCGG - Intergenic
1129859240 15:78847285-78847307 CTCCACCTGCAGCCCCCGTGCGG + Intronic
1129997214 15:80016889-80016911 CTCCACCTGCAGCCCCAGTGCGG + Intergenic
1130132938 15:81159033-81159055 CTCCACCTGCAGCCCCGGTGCGG + Intergenic
1130323864 15:82863078-82863100 CTGCAGCTACTGCCCCTGTGAGG + Intronic
1130938284 15:88488310-88488332 CGCCACCAGCAGAGCCTGTGTGG + Intergenic
1131012633 15:89031648-89031670 CTCCACCTGCGGCCCCGGTGCGG - Intergenic
1131188419 15:90294329-90294351 CTCCTCCTCCATCTCCTGTGGGG - Intronic
1131507857 15:93032239-93032261 CTCCACCTGCAGCCCCGGTGCGG + Intergenic
1131830776 15:96353454-96353476 CTACTCCTGCAGCCGCTCTGGGG - Intergenic
1131846039 15:96491781-96491803 CGCCACCTGCAGCCCCGGTGCGG - Intergenic
1131870205 15:96756345-96756367 ATCCACTGGCAGCCTCTGTGGGG + Intergenic
1131912669 15:97224658-97224680 CTCCACCCGCGGCCCCGGCGCGG + Intergenic
1132085721 15:98906913-98906935 CTCCACCCCCAGCACTTGTGTGG + Intronic
1132097769 15:99000415-99000437 CTCCACCTACGGCCCCAGTGCGG + Intronic
1132098806 15:99008225-99008247 CTCCACCTGCGGCCCTGGTGCGG - Intergenic
1132120421 15:99170802-99170824 CTCCTGCTGCAGCCCCTGGCTGG + Intronic
1132286799 15:100669379-100669401 CTCCAGCAGCCGCCCCTGGGAGG - Intergenic
1132383911 15:101386519-101386541 CTCCTTCTGCAGCCCCTGGCAGG + Intronic
1132511087 16:341655-341677 CTCCACCTGCAACCCCGGTGCGG + Intronic
1132568267 16:632988-633010 CCCAACCTGCACCGCCTGTGGGG - Exonic
1132598964 16:765473-765495 CCCCACGTGCAGCCCCAGAGAGG - Intronic
1132606006 16:794042-794064 CCCCACCTGCAGGCGCCGTGTGG + Exonic
1132836744 16:1958149-1958171 CTCCACCTGCAGCCCCCGTGCGG - Intergenic
1133025699 16:2988153-2988175 CTCTGCCTGCAGACCCTGGGGGG - Intergenic
1133035369 16:3031136-3031158 CTCCTGCTGGAGCCGCTGTGGGG + Exonic
1133236945 16:4391910-4391932 CCCCTCCTGCACCCCCTGCGGGG - Intronic
1133352095 16:5108500-5108522 CTCCACCTGTGGCCCCAGGGCGG - Intergenic
1133362586 16:5186313-5186335 CTCCACCTGCAGCCCCGGTGCGG - Intergenic
1133814211 16:9184149-9184171 CTCCACCTGTGGCCCACGTGCGG - Intergenic
1134640825 16:15827952-15827974 CTCCATCTCCAGCTCCTCTGGGG + Intronic
1134678074 16:16104617-16104639 CTCCACCTGCAGCCCCAGTGTGG - Intronic
1135262052 16:20989591-20989613 CTCCACCTGCAGCCCCGGTGCGG - Intronic
1135299323 16:21312729-21312751 CTCCACCTGCAGCCCTGGTGCGG - Intergenic
1135417374 16:22278833-22278855 CTCCTACTGCAGCCCATGTATGG - Intronic
1135423932 16:22323013-22323035 CTCCACCTGGAGCCTCTGCCGGG - Intronic
1135551349 16:23400544-23400566 CTCCTCCTGCCTCCCCTTTGAGG - Intronic
1136163368 16:28435780-28435802 CTCCACCTGCAGCCCCGGTGCGG + Intergenic
1136199595 16:28679207-28679229 CTCCACCTGCAGCCCCGGTGCGG - Intergenic
1136215941 16:28793380-28793402 CTCCACCTGCAGCCCCGGTGCGG - Intergenic
1136707762 16:32202892-32202914 GTCCACATGCAGTCCCTGGGGGG - Intergenic
1136760147 16:32726519-32726541 GTCCACATGCAGTCCCTGGGGGG + Intergenic
1136807957 16:33143867-33143889 GTCCACATGCAGTCCCTGGGGGG - Intergenic
1136913807 16:34163261-34163283 CTCCCCCCGCAGGCCCTGTGTGG + Intergenic
1137442583 16:48509099-48509121 CTCCACCTGCGGCCCCGGTGCGG + Intergenic
1137735580 16:50720569-50720591 CCCAACCTGCAGCCCCAGGGTGG + Intronic
1137966120 16:52935617-52935639 CTCCTCCAGCTGCCCCAGTGAGG + Intergenic
1138124014 16:54424017-54424039 TGCCACCTCCAGCCACTGTGGGG + Intergenic
1138688860 16:58749268-58749290 CTCCACCTGCGGCCGTGGTGCGG + Intergenic
1138693531 16:58790718-58790740 CTCCACCTGCAGCCCCGGTGTGG - Intergenic
1138818058 16:60225584-60225606 TTCCACCTGCACCCTCTGTCAGG - Intergenic
1138889800 16:61128709-61128731 CTCCACCCGCAGCCCCAGCATGG - Intergenic
1139051550 16:63130044-63130066 CTCCACCTGCAGTCCCCCTGCGG + Intergenic
1139125468 16:64072277-64072299 CTCCATCTGCAGCCCTGGTGCGG - Intergenic
1139209868 16:65066755-65066777 CTGCTCCTCCAGTCCCTGTGAGG + Intronic
1139603127 16:67998627-67998649 CTCCACCTGCATCCCTGGTGCGG + Intronic
1139676481 16:68527112-68527134 CTCCAACTGCAGCCCCGGTGCGG + Intergenic
1140722448 16:77784333-77784355 CTCCACCTGCAGCCCCCATGCGG - Intergenic
1141465671 16:84204564-84204586 CTCCACCTGCAGCCCCGGTGCGG - Intergenic
1141692708 16:85605647-85605669 CTCCCCCTGCACCCCCGGGGGGG + Intergenic
1141837754 16:86553766-86553788 CTCCACCTGCAGCCCCAGTGCGG + Intronic
1142123553 16:88399120-88399142 AGCCACATGCAGCCCCTGGGTGG - Intergenic
1142182741 16:88679147-88679169 CTCAGCCTGCAGCCCCTGAGGGG + Intronic
1142273713 16:89104665-89104687 CTCCACCTCCAGCCACCGTGTGG - Intronic
1142505738 17:362005-362027 CTCCACCTGCAGCCCCGGTGCGG + Intronic
1143135205 17:4709045-4709067 CTCCACCTGCGGCCCCCAAGCGG - Intergenic
1143283437 17:5771628-5771650 CTCCACGTGCGGCCCCGGTGCGG + Intergenic
1143532047 17:7511135-7511157 CTCCAACTACAGCCTCTTTGAGG - Intronic
1143576131 17:7794366-7794388 CTCGTCCTGCAGCCCCCATGAGG - Intronic
1143614169 17:8039618-8039640 CTCCCCCTGCAGCCCCAGCCCGG - Intronic
1143619264 17:8071893-8071915 CACCCCCTGCTGCTCCTGTGGGG + Intergenic
1143664204 17:8347067-8347089 CTCCACTTGCAGCCCCGGTGTGG - Intergenic
1143708581 17:8718026-8718048 CTCCACCTGTGGCCCCAGTGCGG - Intergenic
1144128154 17:12221275-12221297 CTCCACCTGCAGCCCCGAGCAGG + Intergenic
1144467219 17:15506100-15506122 CTCCACCTGCAGCCCCGGTGCGG + Intronic
1144723277 17:17486764-17486786 CTCCACCTGCAGCCCCGGTGCGG + Intronic
1145009214 17:19357937-19357959 CCCCTCCTCCAGACCCTGTGAGG + Exonic
1145050226 17:19654261-19654283 CTCCACCCACAGCCCCGGCGTGG - Intronic
1145191539 17:20844324-20844346 GTCCACATGCAGCCCCTGGGGGG - Intronic
1146740388 17:35278862-35278884 CTCCACCTGCTGCCCTGGTGGGG - Intergenic
1147256191 17:39183906-39183928 CTCCACCTGCTGTTCCTGGGAGG - Intronic
1147373694 17:40011346-40011368 CTACCCCTGCAGCCCTGGTGCGG + Intergenic
1147431885 17:40376241-40376263 CTCCACCTGCAGCCCTGGTGCGG + Intergenic
1147997604 17:44369215-44369237 CTCCACCTGCAGCCCCTGTGCGG + Intergenic
1148023441 17:44568596-44568618 CTCCACCTGTGGCCCCGATGCGG + Intergenic
1148366109 17:47057233-47057255 CTCCACCTGCCGCCCCAGTGCGG - Intergenic
1148670280 17:49404990-49405012 CTCCTCCAGCTGCCCCAGTGAGG - Exonic
1148678179 17:49457171-49457193 CTCCACATCCAGTCTCTGTGGGG + Intronic
1149099189 17:52883924-52883946 CTCCACCTGCGGCCCTGGTGCGG - Intronic
1149627695 17:58091280-58091302 CTCCACCCTCACCCACTGTGTGG - Exonic
1149916475 17:60614050-60614072 CTCCACCTGCGGCCCCGGTGCGG + Intronic
1149993243 17:61394309-61394331 CTCCAGTGGCAGCCGCTGTGGGG - Intergenic
1150314152 17:64154837-64154859 CTCACCCTTCAGCCCCTGGGAGG + Exonic
1150455419 17:65303398-65303420 CTCCGCCTCCACCCCATGTGAGG - Intergenic
1150775885 17:68081026-68081048 CTCCACATGCGGCCCCCATGTGG + Intergenic
1150778351 17:68099692-68099714 CTCCACCTGCAGCCCCGGTGGGG + Intergenic
1150792304 17:68208225-68208247 CTCCACCTGCGGCCCCAGTGCGG + Intergenic
1150804538 17:68308861-68308883 CTCCACCTGCAGCGCCGGTGCGG - Intronic
1151498876 17:74476128-74476150 CTCCACCTCCAGTCCCTCTTTGG + Intronic
1151782601 17:76257596-76257618 CTCCACCTGCAGCCCCAGTGCGG - Intergenic
1151966521 17:77434362-77434384 ACCCACCAGCAGACCCTGTGCGG - Intronic
1152279447 17:79376667-79376689 CTCTTCCTCCAGCCCCCGTGCGG - Intronic
1152585971 17:81189656-81189678 CTCAACCACCAGCCTCTGTGGGG + Exonic
1152630324 17:81408085-81408107 TTCCTCCTGCTGCCCCTGTGTGG + Intronic
1152659089 17:81534256-81534278 CCCCACCCTCAGGCCCTGTGGGG + Intronic
1152685455 17:81691585-81691607 CCCCACCTGCAGCCCAAATGGGG - Intronic
1153070457 18:1098643-1098665 CTCCACCTGTGGCCCCTGTGCGG + Intergenic
1153643983 18:7178615-7178637 CTCCACCTGTGGCCCCGGTGGGG - Intergenic
1153832391 18:8935372-8935394 CTCCACCTGCAGCCCTGGTGCGG - Intergenic
1154057167 18:11023598-11023620 CTCCACCTGCCGCCCCGGTGCGG - Intronic
1154128690 18:11716895-11716917 CTCCACCTGCAGCCCCCGTGCGG - Intronic
1154231085 18:12557095-12557117 CTCCACCCGCAGCCCCAACGCGG - Intronic
1155207975 18:23577578-23577600 CTCCACCTGCAGCCCCGGTGCGG - Intronic
1155294963 18:24376528-24376550 CTCCACCTGCAGCCCCAGTGCGG - Intronic
1155772944 18:29723929-29723951 CTCCACCTGCAGCCCCGGTGTGG + Intergenic
1155852346 18:30788857-30788879 CTCCACCTGCAGCCCTGGTGTGG + Intergenic
1155856309 18:30839107-30839129 CTCCACCTGCAGCCCCAGTGAGG - Intergenic
1156038742 18:32794985-32795007 CTCCACCTGCAGCCCCGGTGCGG + Intergenic
1156329467 18:36106146-36106168 CTACATGTGCAGCCCCTGTCTGG - Intergenic
1156634857 18:39015003-39015025 CTCCACCTCCAGCCACAGAGAGG - Intergenic
1156863726 18:41866169-41866191 CTCCACCTGCAGCCCCGGTGCGG + Intergenic
1156943239 18:42795641-42795663 CTCCACCTGCAGCCCGGGTGCGG + Intronic
1156969745 18:43139931-43139953 CTCCACCTGTGGCCCCAGTGCGG + Intergenic
1157086037 18:44581145-44581167 CTCCACCTGCAGCCCCGGTGTGG + Intergenic
1157621951 18:49021765-49021787 CTCCTCCTGCAGATGCTGTGGGG - Intergenic
1157856836 18:51111792-51111814 CTCCACCTGCGGCCCCGGTGCGG - Intergenic
1157979729 18:52366852-52366874 CTCCACCTGCAGCCCTGGTGCGG - Intronic
1158553954 18:58459786-58459808 CTCCACGTGCAGCACCGGTGCGG + Intergenic
1158697189 18:59714041-59714063 CTCCACCTGCAGCCCCGGTGCGG - Intergenic
1158705683 18:59790404-59790426 CTCCACCTGCAGCCCCGGTGCGG - Intergenic
1159167884 18:64725588-64725610 CTCCACCTGCAGCCCCAGTGCGG - Intergenic
1159230877 18:65605665-65605687 CTCCATCTGCAGCCCCGGTGCGG + Intergenic
1159260416 18:66005917-66005939 CTCCACCTGCAGCCCCGGTGCGG - Intergenic
1159472874 18:68879944-68879966 CTCCACCTGCAGCCCTGGTGCGG - Intronic
1159656034 18:71031286-71031308 CTCCACCTGCAGCCCTGGTGCGG - Intergenic
1160087049 18:75786324-75786346 TTCCTCCTGCAGGCTCTGTGGGG + Intergenic
1160176547 18:76600079-76600101 CTCCACCTGCAGCCCCGGTGCGG - Intergenic
1160198627 18:76777656-76777678 CTCCACCTGCAGCCCCGGTGCGG + Intergenic
1160200001 18:76788524-76788546 CTCCACCTGTGGCCCTGGTGCGG - Intergenic
1160418993 18:78731518-78731540 CATCACCTGGAGCCCCTGCGGGG + Intergenic
1160424932 18:78773188-78773210 CTCCACCAGGAGCCACTGTTGGG + Intergenic
1160582086 18:79888568-79888590 CTCCTCCTGAAGCCGCTGTGCGG + Intronic
1160798368 19:955939-955961 CTCCTCCTGCAGCCCCTGGAGGG - Intronic
1160923048 19:1529508-1529530 CCCCACCTGCAGCCCCGGGCTGG - Intronic
1160994665 19:1877112-1877134 GTCCACATGCAGCCCCTGGGTGG + Exonic
1161545121 19:4875839-4875861 CACCCCCTGCAGACCCTCTGCGG - Intergenic
1161713774 19:5864248-5864270 AGCCACCTGCAGCCCCTAAGTGG + Intergenic
1161716214 19:5877488-5877510 AGCCACCTGCAGCCCCTAAGTGG + Intronic
1162233036 19:9283401-9283423 CTCCACCTGCAGCCCCAGTGCGG - Intergenic
1162261988 19:9541275-9541297 CTCCACCTGCAGCCCCAGTGCGG - Intergenic
1162379002 19:10321111-10321133 CTCCTCCCCCCGCCCCTGTGGGG - Exonic
1162463155 19:10825103-10825125 CTCCACCTGCCGCTCCAGTTGGG - Exonic
1162974935 19:14203202-14203224 CCCCTCCTCCAGCCCCTCTGTGG - Intronic
1162987168 19:14278018-14278040 CTCCACCTGCTGCCCTGGTGCGG + Intergenic
1163181655 19:15608595-15608617 CTCCACCTGCAGCCCTGCTGCGG - Intergenic
1163218921 19:15900095-15900117 CTCCACCTGCAGCCCCGGTGCGG + Intergenic
1163721336 19:18899580-18899602 ATCCACCTGCATCCCCTCTGGGG - Exonic
1163775429 19:19214591-19214613 TACCACCTGCAGCTACTGTGAGG - Intronic
1163818664 19:19483521-19483543 CGCCAGCCGCAGCCCCTCTGCGG - Intronic
1163850272 19:19659052-19659074 TTCCAGCTGCAGACCCTCTGGGG + Intronic
1164143962 19:22498937-22498959 CTCCATCTGCAGCCCCGGTGCGG - Intronic
1164270522 19:23668476-23668498 CTCCACCTGCAGCCCCGGTGCGG - Intronic
1164310529 19:24041726-24041748 CTTCACCTGCAGCCCCGGTGCGG + Intronic
1164975864 19:32571996-32572018 CTCCACCTGCAGCCCCGGTGAGG + Intergenic
1165036452 19:33037013-33037035 CTCCACCTGCGGCCCTGGTGTGG + Intronic
1165266992 19:34668557-34668579 CTCCACCTGTGGCCCCGGTGCGG + Intronic
1165321527 19:35088388-35088410 CTTCAACTGCAACCCCAGTGAGG + Intergenic
1165415464 19:35691045-35691067 CTCCACCTGCAGCCCCAGTGCGG - Intergenic
1166036147 19:40170089-40170111 CTCCACCTGCAGCCCCAGTGCGG - Intergenic
1166248585 19:41549305-41549327 CTCCTTCTGCTGCCCCTGTGGGG + Intergenic
1166486942 19:43221870-43221892 CTCCATCTGCAGCCCCAGTGTGG - Intronic
1166836889 19:45672843-45672865 CGAAACCTGCAGCCACTGTGGGG - Exonic
1166871193 19:45872208-45872230 CAGCACCTGCAGCCCCCCTGGGG + Exonic
1168069736 19:53942831-53942853 CTCCACCCGCAGCCCCGGGGTGG + Exonic
1168119235 19:54242444-54242466 CTCCCCCAGCTGCCCATGTGTGG + Intronic
1168176838 19:54632798-54632820 CTCCCCCGGCAGGGCCTGTGCGG - Intronic
1168187626 19:54709889-54709911 CTCCCCCAGCAGGGCCTGTGCGG - Intergenic
1168379423 19:55907460-55907482 CTCCCACTGCAGCCCCCGAGTGG - Intronic
1202706913 1_KI270713v1_random:31049-31071 CTCCACCTGCTGTCCTTGTTGGG + Intergenic
924967442 2:91401-91423 CTCCACCTGCTGCCCCAGTGTGG + Intergenic
925079663 2:1053977-1053999 CTCCCTCTGCAGGCCCTGTGAGG + Intronic
925088622 2:1134674-1134696 CTCCACCTGCAGCCCCGGTGGGG - Intronic
925537739 2:4935263-4935285 CTCCACCTGCAGCCCCGGTGCGG - Intergenic
925750790 2:7089432-7089454 CTCCAGCGGGAGCCGCTGTGGGG - Intergenic
926074824 2:9933558-9933580 CACCACCTGTGGCCCTTGTGTGG + Intronic
926225081 2:10961505-10961527 CTCCAGCTGCTGCCTCTGTCTGG + Intergenic
926474701 2:13308258-13308280 CTCCACCTGCAGCCCGGGTCTGG - Intergenic
926616560 2:15002483-15002505 CTCCACCTGCAGTCCCGGTGCGG - Intergenic
927085572 2:19671573-19671595 GTCCACCTCCAGAGCCTGTGTGG - Intergenic
927357146 2:22186710-22186732 CTCCACCTGCGGCCCCAGTGCGG + Intergenic
927777863 2:25915873-25915895 CTCCACCTGCAGCCCCCGTGGGG + Intergenic
927848611 2:26485017-26485039 CCCCATCTTCAGCCCCTCTGGGG + Intronic
927851531 2:26503112-26503134 CTCCCCCAGCATCCCCTCTGTGG - Intronic
927900475 2:26814771-26814793 CTCCACCTGCAGCCCTGGTGCGG + Intergenic
927930640 2:27041350-27041372 CTCCACCTGAAGCCTGGGTGTGG + Exonic
928282913 2:29964465-29964487 CCCCAGCAGCAGCCCCTTTGTGG + Intergenic
928321539 2:30287242-30287264 CTCAGGCTGCAGCCACTGTGGGG + Intronic
928493137 2:31804052-31804074 CTCCACCTGCAGCCCCGGGCGGG + Intergenic
928753266 2:34494705-34494727 CTCCACCTGCAGCCCTGGTGCGG + Intergenic
928936971 2:36688672-36688694 CTCCCTCTGCAGCCCCGGTGCGG + Intergenic
929109933 2:38397674-38397696 CCCCACCTGCAACCCTGGTGTGG + Intergenic
929201926 2:39244687-39244709 CTCCACCTGCAGCCCCTGTGCGG + Intergenic
929233780 2:39585767-39585789 CTCCACCTGCAGCCCCGGTGCGG + Intergenic
929379759 2:41336002-41336024 CTCCACCTGCAGCCCTGGTGCGG + Intergenic
929592737 2:43157741-43157763 CTCAAGATGCAGTCCCTGTGGGG - Intergenic
929890796 2:45917619-45917641 CTCCACCTGCAGCCCCAGTGCGG - Intronic
930017502 2:46981103-46981125 CTCAACCTTCAGCCCCTCTCTGG + Intronic
930038085 2:47100144-47100166 CTCCACCTGCAGCCCTGGTGTGG + Intronic
930039285 2:47107691-47107713 CTCCACCTGCAGCCCTGGTGCGG + Intronic
930420811 2:51151563-51151585 CTCCACCTGCAGCCCCAGTGTGG - Intergenic
930485583 2:52007220-52007242 CTCCACCTGCAGCCCCGGTTTGG + Intergenic
930970151 2:57385595-57385617 CTCCACCTCTAGCTGCTGTGGGG + Intergenic
931708761 2:64969416-64969438 CTCCACCTGCAGCCCCAGAGTGG + Intergenic
932104576 2:68931121-68931143 CTCCACCTGCTGCCCCTCTGTGG + Intergenic
932239999 2:70148717-70148739 CTCCACCTGCAGCCCCAGTGTGG + Intergenic
932413120 2:71558857-71558879 CTCCACCTGAGGCCACTGAGTGG + Intronic
932486549 2:72087293-72087315 CTTCACCTGCAGCCCCGGTGCGG + Intergenic
932521844 2:72422238-72422260 CTCCACCTGCAGCCCCAGTGCGG + Intronic
932902117 2:75711986-75712008 CTCCACCTGCAGCCCCGGTGCGG + Intergenic
933442028 2:82326232-82326254 CTCCACCTGCAGCCCCGGTGCGG - Intergenic
933457985 2:82541302-82541324 CTCCACCAGCAGTCCCTCAGTGG + Intergenic
933487183 2:82938390-82938412 CTCCACCTGCAGCCCTGGTGCGG - Intergenic
933506383 2:83181411-83181433 CTCCACCTGCGGCCCCGGTGCGG + Intergenic
933511398 2:83245915-83245937 CTCCACCTGCAGCCCCCATGCGG - Intergenic
933712089 2:85334362-85334384 CTCCACCTGCGGCCCTAGTGCGG - Intergenic
934738438 2:96702243-96702265 CCCCAGCTGCAGCCTCAGTGAGG - Intergenic
934898563 2:98139414-98139436 CTCCACCTGAAGCCCCTGTGTGG + Intronic
935312518 2:101799482-101799504 CTCCTTCTTCAGCCCCTCTGTGG + Intronic
935878295 2:107536039-107536061 CTCCACTTGCAGCTCCCATGCGG - Intergenic
935896774 2:107747289-107747311 CTCCACCTGCAGCCCCGGTGCGG - Intergenic
936172640 2:110190181-110190203 CTCCACCTGCAGCCCTGGTGCGG - Intronic
936476773 2:112846373-112846395 CTCCACCTGAACGCCCAGTGTGG - Intergenic
936581451 2:113704371-113704393 CTCCACCTGTGGCCCCTGTGCGG - Intergenic
937009347 2:118548187-118548209 CTGCACTGGCAGCCCCTGTCTGG - Intergenic
937209526 2:120259699-120259721 CTCCACCTGCAGCCCCGGTGCGG - Intronic
937596918 2:123684187-123684209 CTCCACCTGCAGCCCCGGTGTGG + Intergenic
937746665 2:125422660-125422682 CTCCACCTGCAGCCCCAGTGTGG + Intergenic
937905795 2:127052226-127052248 GCCCACCTCCAGCCCCTGTCTGG - Intronic
937955578 2:127420187-127420209 CTGCCCTGGCAGCCCCTGTGTGG - Intronic
938249678 2:129805105-129805127 CTCCAGCTGCAACTCCTGGGTGG + Intergenic
938401094 2:130991856-130991878 CTCCACCTGCAGCCCCGGTGCGG + Intronic
938556655 2:132430669-132430691 CTGCTCATCCAGCCCCTGTGAGG + Intronic
939003197 2:136758832-136758854 CTCCACCTGCGGCCCCTGTGCGG + Intergenic
939229834 2:139410753-139410775 CTCCACCTGCAGCCCCGGTGCGG + Intergenic
939281824 2:140074191-140074213 CTCCACCTGCAGCCCAGGTACGG + Intergenic
939465203 2:142546472-142546494 CTCCACCTACGGCCCAGGTGTGG + Intergenic
939738701 2:145880852-145880874 CTCCACCTGCAGCCCCAGTGCGG - Intergenic
939745351 2:145960522-145960544 CTCCACCTGCGGCCCTGGTGTGG - Intergenic
939777290 2:146403640-146403662 CTCCACCTGCAGCCCCAGTGCGG - Intergenic
939972478 2:148678349-148678371 CTCCATCTGCAGCCCTGGTGCGG - Intronic
940112591 2:150171050-150171072 CTCCACCTGCGGCCCCAGTTCGG - Intergenic
940292426 2:152090259-152090281 CTCCACCTGCTGCCCCAGACAGG - Intronic
940485023 2:154287405-154287427 CTCCTCCAGCTGCCCCAGTGAGG + Intronic
940666635 2:156617983-156618005 CTCCACCTGCAGCCCCAGTGCGG - Intergenic
940784539 2:157967863-157967885 CTCCACCTGCAGGCTCCGTGGGG - Intronic
941240159 2:163026688-163026710 CTACACCTGCAGCCCCGGTGCGG + Intergenic
941309319 2:163909936-163909958 CTCCACTTGTGGCCCCAGTGCGG + Intergenic
941309855 2:163914029-163914051 CTCCACCTGCAGCCCTGGTGCGG + Intergenic
941397859 2:164994703-164994725 CTCCACCTGCAGCCCCCGTGCGG - Intergenic
941705802 2:168657387-168657409 CTCCACCTGCAGCCCCGGTGCGG - Intronic
941712050 2:168724846-168724868 CTCCACCTGCAGCCCCGGTGGGG - Intronic
941820861 2:169841945-169841967 CTCCACCTGTAGCCCCGGTGCGG + Intronic
942018069 2:171837253-171837275 TTCCAATTGCAGCTCCTGTGAGG + Exonic
942540260 2:177008262-177008284 CTCCACCTGCGGCCCTGGTGTGG + Intergenic
942620081 2:177836083-177836105 CTCTACCTGTGGCCCCAGTGCGG + Intronic
943494676 2:188606343-188606365 CTCCACCTGCAGCCCTGGTGCGG - Intergenic
943680267 2:190760899-190760921 ATCTATCTGCAGCCCCGGTGCGG - Intergenic
943790101 2:191921999-191922021 CTCCACCTGCGGCCCCGGTGCGG + Intergenic
943835224 2:192508380-192508402 CTCCACCTGCAGCCCCAGTGCGG + Intergenic
943941384 2:194002706-194002728 CTCCACCTGCGGCCCCAAAGCGG - Intergenic
943942793 2:194020572-194020594 CTCCACCTGTGGCCCCAGTGTGG + Intergenic
944729709 2:202503782-202503804 CTCCACCTGCAGCCCAGGTGTGG + Intronic
944857861 2:203785522-203785544 CTCCACCTGCAGCCCCGGTGCGG - Intergenic
945069701 2:205977596-205977618 CTTCACCTGCGGCCCCTGTGCGG + Intergenic
945451427 2:210000565-210000587 CTCCACCTGCCGCCCCAGTATGG - Intergenic
945575404 2:211524326-211524348 CTCCACCTGCAGCCCCCGTGAGG - Intronic
945745850 2:213718903-213718925 CTCCACCTGCAGCCCTGGTGCGG + Intronic
945872761 2:215245689-215245711 CTCCACCTGCAGCCCCGGTGCGG - Intergenic
946054063 2:216885635-216885657 CTCCACCTGCAGCCCCAGTGTGG + Intergenic
946201915 2:218075539-218075561 CTCCCTCTACAGCCCCTCTGGGG - Exonic
946358015 2:219201376-219201398 CTCCACCTGCAGCCACGGTGCGG - Intronic
946376568 2:219313188-219313210 CTCCACCTGCGGCCCCGGTGTGG + Intergenic
946923492 2:224603650-224603672 CTCCATCTGCAGCCCTGGTGCGG - Intergenic
946982095 2:225229397-225229419 CTCCACCTGCAGCCCCGATGCGG - Intergenic
947026704 2:225744545-225744567 CTCCACCTGCAGCCCTGGTGCGG + Intergenic
947230064 2:227875532-227875554 CACCAACTGCAGACCCTGGGTGG - Intronic
947720499 2:232366752-232366774 CTCCACCTGCAGCCCCGGTGCGG + Intergenic
947917002 2:233839274-233839296 CACCATGTGCAGCCCCTGGGAGG + Intronic
947931987 2:233972417-233972439 CTCCACCTGCAGCCGCGGTGCGG - Intronic
948403866 2:237703171-237703193 CTCAACCTGCAGGCCGTCTGGGG + Intronic
948449042 2:238057802-238057824 CTCCACCTGCAGCCGCAGTGGGG - Intronic
948591589 2:239054020-239054042 CTCCACCCCCAGCCTCTGTGAGG - Intronic
948808169 2:240461843-240461865 CTCCACCAGCAGCCCCTCCCTGG + Intronic
948920756 2:241064854-241064876 CTGCTTCTCCAGCCCCTGTGGGG + Exonic
949022345 2:241748697-241748719 CTCCACCTTCAGCCCCTGGTGGG + Intronic
949079530 2:242085780-242085802 CACCACCCTAAGCCCCTGTGAGG + Intergenic
1169115074 20:3059314-3059336 CTGCACCTGCAACCGATGTGTGG - Intergenic
1169645284 20:7803508-7803530 CTCCACCTGCAGCTCTCCTGCGG - Intergenic
1169814386 20:9641538-9641560 CTCCACCTGCAGCCCCGGTGCGG - Intronic
1169849259 20:10032090-10032112 CTCCACCTGCAGCTCTCGTGCGG + Intronic
1170013872 20:11758569-11758591 CTCCACCTCCAGCCCCTGGCAGG + Intergenic
1170230816 20:14044777-14044799 CTCCACCTGCAGCCCCAGTGCGG - Intronic
1170806778 20:19639577-19639599 CTCCACCTGCAGCCCCAGTGCGG - Intronic
1170989962 20:21292291-21292313 CTCCACCTGCAGCCCCGGTGCGG + Intergenic
1171318779 20:24220670-24220692 CTCCACCTGCAGCCCCGGTGTGG - Intergenic
1171370347 20:24658418-24658440 CACGGCCTGCAGCTCCTGTGTGG - Intronic
1171794816 20:29558583-29558605 CTAGACCGGGAGCCCCTGTGGGG - Intergenic
1171810256 20:29741337-29741359 CTCCCCCCGCAGGTCCTGTGTGG - Intergenic
1171853640 20:30325682-30325704 CTAGACCGGGAGCCCCTGTGGGG + Intergenic
1171865332 20:30484757-30484779 CTCCCCCAACAGGCCCTGTGTGG - Intergenic
1171908718 20:30921834-30921856 CTCCCCCCGCAGGCCCTGTGTGG + Intergenic
1171973348 20:31578517-31578539 CTCCACCTGCAGCCCCTGTGCGG - Intergenic
1172431782 20:34898750-34898772 CTCCACCTGCAGCCCCAGTGCGG - Intronic
1172626982 20:36352992-36353014 CTCCTCCTGCGTCCACTGTGTGG + Intronic
1173195460 20:40910418-40910440 CTCCACCTGCAGCCCCAGTGCGG - Intergenic
1173195758 20:40911595-40911617 CTCCACCTGCAGCCCCAGTGCGG + Intergenic
1173601668 20:44299546-44299568 CTCCACCTGCAGCCCCGGTGCGG + Intergenic
1173778840 20:45736303-45736325 CTCCACCTGCGGCCCCAGAGCGG + Intergenic
1174162823 20:48564058-48564080 CTCCACCTGCGGCCCCAGTATGG - Intergenic
1174413771 20:50353499-50353521 CTCCAGCTCCTTCCCCTGTGTGG - Intergenic
1175210141 20:57348809-57348831 CTCCACCTGCAGCCCCGGTGCGG + Intergenic
1175912343 20:62410886-62410908 CCCCAACAGCAGCCCCTGGGAGG - Exonic
1176144788 20:63560747-63560769 GCCCACCTGCAGCCCCTGGGGGG - Intronic
1176230996 20:64032833-64032855 CTCCTCCTGCTGCTCCTGGGGGG - Exonic
1176332232 21:5559600-5559622 CTACACCTGCAGACCCTGTGGGG - Intergenic
1176344767 21:5733457-5733479 CTCCACCTGCGGCCCTGGTGCGG - Intergenic
1176351581 21:5854041-5854063 CTCCACCTGCGGCCCTGGTGCGG - Intergenic
1176395525 21:6261351-6261373 CTACACCTGCAGACCCTGTGGGG + Intergenic
1176441632 21:6727753-6727775 CTACACCTGCAGACCCTGTGGGG - Intergenic
1176465894 21:7054822-7054844 CTACACCTGCAGACCCTGTGGGG - Intronic
1176489455 21:7436600-7436622 CTACACCTGCAGACCCTGTGGGG - Intergenic
1176500060 21:7590998-7591020 CTCCACCTGCGGCCCTGGTGCGG + Intergenic
1176539088 21:8131527-8131549 CTCCACCTGCGGCCCTGGTGCGG - Intergenic
1176558039 21:8314572-8314594 CTCCACCTGCGGCCCTGGTGCGG - Intergenic
1176671108 21:9735948-9735970 CTCCACCTGCGGCCCCAGTGCGG + Intergenic
1176966546 21:15218524-15218546 CTCCACCTGCAGTCCCGGTGCGG - Intergenic
1177497002 21:21902836-21902858 CTCCACCTGCAGCCCCCGTGTGG + Intergenic
1177565761 21:22818807-22818829 CTCCACCTGCAGCCCCGGTGTGG - Intergenic
1177637687 21:23807427-23807449 CTCCACCTGCAGCCCCAGTGTGG + Intergenic
1178074244 21:29000551-29000573 CTCCACCTGCAACCCGGGTACGG + Intergenic
1178327062 21:31654597-31654619 CTCCACCTGCAGCCCAGGTGCGG + Intergenic
1178398814 21:32265743-32265765 CTCCACCTGCAGCCCCGGTGCGG + Intergenic
1178585577 21:33868266-33868288 CTCCAGCTGCAGCCCCGGTGTGG - Intronic
1178832761 21:36070252-36070274 CTCCGCCTGCAGCTGCTGTACGG - Exonic
1178983284 21:37283134-37283156 CTCCAGCTGCAGCCCCGGTGTGG - Intergenic
1179309204 21:40181953-40181975 GTCCCACTGCAGCCTCTGTGAGG + Intronic
1179514161 21:41894943-41894965 CTCCACGAGCAACACCTGTGAGG + Intronic
1179517804 21:41921015-41921037 CTCCAGCAGCACCCCCTTTGAGG - Intronic
1179784905 21:43724061-43724083 CCCCACCAGAAGACCCTGTGAGG + Intronic
1179898949 21:44379014-44379036 CACCAACGGCACCCCCTGTGTGG + Exonic
1179967095 21:44813610-44813632 CGCCACCTGCAGCCCCAGAATGG + Intronic
1179968583 21:44820579-44820601 CTTCTCCTGCAGCTCCTGTCAGG - Intergenic
1180019890 21:45116234-45116256 CTCCATCTTCAGCCCCAGGGTGG + Intronic
1180077150 21:45468707-45468729 CTCCAGCTCCAGGCCCCGTGAGG - Exonic
1180179678 21:46112355-46112377 CGTCACCGGCAGCCCCTGCGGGG + Exonic
1180189186 21:46154553-46154575 CACCACCTGCAGCCCCTTGTGGG - Intronic
1180221785 21:46363950-46363972 CGCCATCTGCAGTCCCTGTGAGG + Intronic
1180312057 22:11249641-11249663 CTCCCCCCGCAGGCCCTGTGTGG - Intergenic
1180740972 22:18053318-18053340 CTCCACCTGCAGCCCCTGTGCGG - Intergenic
1180755159 22:18155899-18155921 CTCCACCTGCGGCCCAGGTGTGG + Intronic
1181077604 22:20392359-20392381 CTCCACCTGCGGCCCCGGTGCGG - Intergenic
1181120755 22:20667732-20667754 GTCCACATGCAGCCCCTGGGGGG + Intergenic
1181333720 22:22114759-22114781 GTCCACATGCAGCCCCTGGGGGG + Intergenic
1181450473 22:23017001-23017023 CTCCACCTGCAGCCCCGGCGCGG - Intergenic
1181725310 22:24806851-24806873 CTCCTCCAGCACACCCTGTGGGG - Intronic
1181737399 22:24892537-24892559 CAGCACCTGTAGCCCATGTGGGG + Intronic
1182269416 22:29144248-29144270 CTGCACCTGCCGCCCCTGGGAGG + Intronic
1182300008 22:29331932-29331954 CTCCCCCTGCCATCCCTGTGGGG - Intronic
1182521428 22:30886801-30886823 CCCCACCTCCATTCCCTGTGAGG - Intronic
1183062530 22:35345057-35345079 CTCCAACTCCTGCCCCTGTGTGG + Intronic
1183380104 22:37486374-37486396 CTCCACCTGCTCCCGCTGTCCGG + Exonic
1183448236 22:37874450-37874472 CTCCGCCTGCACTCCCTGTTAGG + Exonic
1183508603 22:38222517-38222539 CCCCACCGGCACCCCCTGGGTGG - Intronic
1183523073 22:38307669-38307691 CTCCACCTTCGGTACCTGTGGGG - Intronic
1183680796 22:39328106-39328128 CTCCGCCTGCAGCCCCAGCAGGG - Intergenic
1183685307 22:39358011-39358033 CTCCACCTGCAGCCCCGGTGCGG + Intronic
1183721239 22:39562762-39562784 GTCCTACTGCAGCACCTGTGGGG - Intergenic
1184248836 22:43249008-43249030 CTCCACCAGCACCCCCTGACTGG - Intronic
1184584326 22:45437140-45437162 CTCCACCTGCAGCCCCGGTGCGG + Intergenic
1184721395 22:46316131-46316153 CTCTGCCTGCAGGCCCTGTGGGG + Exonic
1184840401 22:47049104-47049126 CTCCACCTGGGTCCCCAGTGTGG + Intronic
1184906176 22:47488255-47488277 CTCCACCTGCAGCCCCGGTGCGG - Intergenic
1185121674 22:48975134-48975156 GGCCACCTGCAGCCCATGAGGGG + Intergenic
1185231503 22:49686710-49686732 CTCCACCTGCAGACCCACAGGGG + Intergenic
1203244038 22_KI270733v1_random:47882-47904 CTCCACCTGCGGCCCTGGTGCGG - Intergenic
949259050 3:2084039-2084061 CTCCACCTGCAGCCCCGGTGCGG + Intergenic
950203669 3:11061784-11061806 CTCCACCTGCAGCCCCTGTGCGG + Intergenic
950207954 3:11094411-11094433 CTCCACCTGCGGCCCCTGTGTGG + Intergenic
950256894 3:11513194-11513216 CTCCACCTGCAGCCCCGGTGCGG - Intronic
950418620 3:12883261-12883283 CTCCACCTGTGGCCCCGGTGCGG + Intergenic
950470231 3:13180128-13180150 CTCCACCTGCCGCCCCAGTGCGG + Intergenic
950513298 3:13447145-13447167 CTCCACCTGCAGCCCCAGTGCGG - Intergenic
950548980 3:13655196-13655218 CTCAACCCGCAGCCCCTGGCCGG + Intergenic
950632708 3:14293583-14293605 CTCCACCTGCGGCCCCCGTGCGG + Intergenic
950929466 3:16774128-16774150 CTCCACCTGCAGCCCCAGTGCGG + Intergenic
950971513 3:17193248-17193270 CTTGCCCTGCAGCCCCTGTTGGG - Intronic
951146522 3:19234233-19234255 CTCCACCTGCAGCCCCGGTGCGG - Intronic
951332886 3:21387200-21387222 CTCCACCTGCAGCCCCGGTGTGG - Intergenic
951898420 3:27633053-27633075 CTCCCGCTGCAGGCCCTGCGCGG - Intergenic
952058019 3:29473453-29473475 CTCCACCTGCGGCCTCCGTGCGG - Intronic
952275320 3:31870527-31870549 CTCCACCTGCAGCCCCGGTGCGG + Intronic
952355449 3:32579126-32579148 CTCCACCTGCGGCCCCAGTGGGG + Intergenic
952360542 3:32626046-32626068 CTCCACCTGCCGCCCCTGTGAGG + Intergenic
952398300 3:32940094-32940116 CTCCACCTGCAGCCCCAGTGCGG + Intergenic
952593712 3:34988789-34988811 CTCCACCTGCAGCCCCAGTGGGG + Intergenic
952713383 3:36453714-36453736 CTCCACCTGCAGCCCCGGTGCGG + Intronic
952730720 3:36634319-36634341 CTCCATCTGCAGCCCCGGTGCGG + Intergenic
952795320 3:37233430-37233452 CTCCACCTGCAGCCCCAGTGCGG + Intergenic
953002960 3:38951563-38951585 CTCCACCTGCGGCCCCGGTGCGG + Intergenic
953062010 3:39435123-39435145 CTTCACCTGCTGCCCCAGTATGG - Intergenic
953089901 3:39713727-39713749 CTCCACCTGCAGCCCCGGTGCGG + Intergenic
953124434 3:40077857-40077879 CCCCACCTGCAGCCCCGGTGCGG - Intronic
953307533 3:41844117-41844139 CTCCACCTGCGGCCCCGGTGGGG - Intronic
953522426 3:43656375-43656397 CTCCACCTGCAGCCCCTGTGCGG - Intronic
953714689 3:45307099-45307121 CTCCACCTGTGGCCCCAGTGTGG + Intergenic
953854269 3:46488943-46488965 CTGCACCTGCAGCCTGGGTGTGG + Intergenic
954089261 3:48271889-48271911 CTCCACCCACAGCCCCAGTGCGG - Intronic
954226134 3:49182613-49182635 CTCCACCTGCAGCCCCAGTGCGG - Intronic
954539715 3:51385359-51385381 CGCCACCGCCAGCCCCTGCGTGG - Exonic
954620208 3:51990984-51991006 CTCCACCTGCAGCCCCGGTGCGG + Intergenic
954664780 3:52245941-52245963 CTCCAGCTCCAGCCCCGGGGCGG + Intronic
955183426 3:56692292-56692314 CTCCACCTGCAGCCCCAGTGCGG + Intergenic
955210356 3:56934877-56934899 CTCCACCTGCAGCCCCGCTGCGG + Intronic
955266389 3:57449294-57449316 CTCCACCTGCAGCCCGGGTGTGG - Intronic
955405565 3:58623596-58623618 TCCCACCTGGAGCCCCTGTCGGG - Intronic
955449549 3:59051269-59051291 CTCCACCTGCGGCCCCAGTGCGG + Intergenic
955466137 3:59238886-59238908 CTCCACCGGAAGGCCCTTTGTGG - Intergenic
956481524 3:69677857-69677879 CTCCACCTGCAGCCCCGGTGCGG + Intergenic
956632669 3:71331509-71331531 CTCCACCTGCGGCCCCGGTGCGG + Intronic
956667124 3:71652526-71652548 CTCCACAGCCAGGCCCTGTGGGG + Intergenic
956675567 3:71728972-71728994 CTCCATCTGCAGCCTCCCTGAGG - Intronic
956786532 3:72647507-72647529 CTGCACCTGCTGCCCCTTGGCGG - Intergenic
956855331 3:73269604-73269626 CTCCACCTGCAGCCCCGGTGCGG + Intergenic
957009114 3:74985074-74985096 CTCCACCTGCAGCCCCGGTGTGG - Intergenic
957056099 3:75444383-75444405 CTCCACCTGTGGCCCCCGTGTGG - Intergenic
957074150 3:75588166-75588188 CTCCACCTGTGGCTCCTGTGTGG + Intergenic
957277539 3:78108800-78108822 CTCCACCTGCAGCCCCCGAGCGG + Intergenic
957362154 3:79173734-79173756 CTCCACCTGTGGCCCCAGTGCGG + Intronic
957419591 3:79951319-79951341 CTCCACCTGCAGCCCCCATGCGG - Intergenic
957446188 3:80314860-80314882 CTCCACCTGCAGCCCCAGTGTGG + Intergenic
957556225 3:81767325-81767347 CTTCACCTGTGGCCCCAGTGCGG - Intergenic
957560094 3:81811957-81811979 CTCCACCTGCAGCCCCGGTGCGG - Intergenic
957631009 3:82715742-82715764 CTCCACCTGCAGCCCCCATGCGG + Intergenic
957804832 3:85133809-85133831 CTCCACCTGCAGCCCCGGTGAGG - Intronic
957829939 3:85504624-85504646 CTCCACCTGCAGCCCCGGTGAGG - Intronic
957919609 3:86731459-86731481 CTCCACCTGCAGCCCTGGTGCGG - Intergenic
957921894 3:86758011-86758033 CTCTACCTGCAGCCCCAGTGCGG + Intergenic
957995177 3:87679510-87679532 CTCCACCTGCAGCCCGCGTGTGG + Intergenic
958022711 3:88016100-88016122 CTCCACCTGCAGCCCCGGTGGGG + Intergenic
958810693 3:98857921-98857943 CTCCACCTGCAGCCCCGGTGCGG - Intronic
960149728 3:114238238-114238260 CTCCACCTGCAGCCCCGGTGCGG - Intergenic
960199338 3:114812645-114812667 CTCCACCTGCAGCCCGGGTGCGG - Intronic
960636799 3:119792533-119792555 CTCCTCCAGCTGCCCCAGTGAGG + Intronic
960685557 3:120290081-120290103 CTCCACCTGTGGCCCCAGTGTGG + Intergenic
960868518 3:122227163-122227185 CTCCACCTGTGGTCCCGGTGCGG - Intronic
960949389 3:122989274-122989296 ACCCACCAGCAGCCTCTGTGCGG - Intronic
961036086 3:123642584-123642606 CGCCACCTGCAGGCCATTTGGGG - Intronic
961205103 3:125075630-125075652 CTCCTGCTGCAGGCTCTGTGGGG - Intergenic
961279942 3:125758574-125758596 CTCCACCTGCAGCTCCTGTGCGG - Intergenic
961298291 3:125904304-125904326 CTCCACTTGCGGCCCCAGTGCGG + Intergenic
961330577 3:126135738-126135760 CTCCTCCTGGGGCCCCAGTGAGG + Intronic
961460533 3:127047089-127047111 CTCCACCTGCAGCCCCGGTGCGG + Intergenic
961461932 3:127056219-127056241 CCAGACCTGCAGCCCCTGTGCGG - Intergenic
961464983 3:127076233-127076255 CTCCACCTGCGGCCCCGGTGTGG - Intergenic
961569052 3:127785202-127785224 CTCCACCTGCAGCAGGTGTGTGG - Intronic
961637213 3:128341116-128341138 CACCACCTGCAGGCACCGTGAGG - Intronic
961874453 3:130011005-130011027 CTCCACCTGCGGCTCCTGTGTGG + Intergenic
962212566 3:133491414-133491436 CTCCACCTGCACACCCTCAGAGG + Intergenic
962283679 3:134070209-134070231 TTCCACCTGCAGCCCCGGTGTGG - Intronic
962383694 3:134916304-134916326 CTCCACCTGTGGCCCTCGTGTGG - Intronic
962398683 3:135039375-135039397 CTCCACCTGCAGCCCCAGTGCGG - Intronic
962473264 3:135732231-135732253 CTACAACTGCAGCCTCTGTTGGG + Intergenic
962591002 3:136889949-136889971 CTCCACCTGCAACCCCTGTGCGG - Intronic
962600428 3:136987536-136987558 CTCCACCGGCAGCCCTGGTGCGG - Intronic
962758323 3:138485061-138485083 CTCCACCTGCAGCCCTGGTGTGG + Intergenic
962814754 3:138987944-138987966 AGCGAGCTGCAGCCCCTGTGAGG - Intergenic
962998203 3:140651803-140651825 CTCCACCTGTGGCCCTGGTGTGG + Intergenic
963397286 3:144750220-144750242 CTCCACCTGCAGCCCTGGTGCGG + Intergenic
963440480 3:145333789-145333811 CTCCACCTGCAGCCCCGGTGCGG + Intergenic
963509085 3:146225380-146225402 CTCCACCTGCAGCCCTGCTGCGG - Intronic
963651757 3:147989325-147989347 TTCCACCTGCAGTCCTGGTGCGG - Intergenic
963673440 3:148280514-148280536 CTCCACCTGCGGCCCCAGTGCGG - Intergenic
963760662 3:149284398-149284420 CTCCACCTGCGGCCCTGGTGCGG + Intergenic
964014456 3:151928568-151928590 CTCCACCTGCAGCTCCGGTGCGG + Intergenic
964032396 3:152152831-152152853 CTCCACCTGCAGCCCCGGTAAGG + Intergenic
964139153 3:153378284-153378306 CTCCACCTGCAGCCCCAGTGCGG - Intergenic
964378585 3:156073528-156073550 CTCCACCTGTGGCCCCGTTGCGG + Intronic
964381164 3:156099836-156099858 CTCCACCTGCGGCCCCGGTGAGG + Intronic
964444073 3:156740989-156741011 CTCCACCTGCATCCCCTGTGCGG + Intergenic
964491794 3:157243930-157243952 CTCCTCCCTCAGCCCCTGAGTGG - Intergenic
964787934 3:160420174-160420196 CTCCACCTTCAGCCAATTTGAGG - Intronic
964802822 3:160573937-160573959 CTCCACCTGCAGCCAGGGTGCGG - Intergenic
965078068 3:164003380-164003402 CTACACCTGCAGCCCCAGTGCGG + Intergenic
965109348 3:164401837-164401859 CTCCACCTGCAGCCCCGGTGCGG - Intergenic
965200275 3:165649265-165649287 CTCCACCTGCAGCCGCAGTGCGG - Intergenic
965220828 3:165924285-165924307 CTCCACCTGCCGCCCAGGTGCGG - Intergenic
965245169 3:166258416-166258438 CTCCATCTGCAGCCCTGGTGTGG - Intergenic
965288115 3:166843223-166843245 CTCCACCTGCAGCCCTGGTGTGG + Intergenic
965298198 3:166976245-166976267 CTCCACCTGCAGCCCCGGTGCGG + Intergenic
965500201 3:169446685-169446707 CCACACCTGCACCCACTGTGAGG + Intronic
965753159 3:171998819-171998841 CTCCACCTGCAGCCCCAGTGTGG - Intergenic
965837444 3:172867194-172867216 CTCCACCTGCAGCCCTGGTGTGG + Intergenic
965943410 3:174211920-174211942 CTCCACCTGCAGCCCCAGTGCGG - Intronic
966096714 3:176213364-176213386 CTCCACCTGCAGCCCCAGTGCGG - Intergenic
966372359 3:179263002-179263024 CTCCACCTGTGGCCCCGGTGCGG - Intronic
966548906 3:181182967-181182989 CTCCACCTGCAGCCCCTGTGAGG - Intergenic
966725074 3:183101312-183101334 CTCCACCTGCAGCCCCGGTGCGG + Intronic
967154775 3:186682383-186682405 CTCCAACTGAAGGCCTTGTGGGG - Intergenic
967594845 3:191316961-191316983 CTCCGCCGGCAGCCCCGGCGTGG - Intronic
967718431 3:192789444-192789466 CTCCACCTGCAGGCCTGGTGCGG + Intergenic
968181522 3:196598986-196599008 CTCCACCTGCAGCCCCAGTGCGG - Intergenic
968412741 4:403948-403970 CTCCACCTGCAGCCCCGGCGCGG - Intergenic
968480039 4:829213-829235 CTCCATCCCCAGCCCCAGTGAGG + Intergenic
968573565 4:1354729-1354751 CTGCACCTTCAGGCCCTCTGGGG - Exonic
968998907 4:3964664-3964686 CTCCACCTGCGGCCCCCGTGAGG - Intergenic
969017769 4:4115766-4115788 CTCCACCTGCGGCTCCTGTGTGG + Intergenic
969303078 4:6308982-6309004 CTCCACCTGCAGCCCGGTTGGGG - Intergenic
969362426 4:6673135-6673157 CTCCACCTGCAGCCCTGGTGTGG + Intergenic
969440811 4:7215541-7215563 CTCCACCTGCAGCCCCGGTGCGG + Intronic
969516442 4:7650784-7650806 CTCCATCAGCTGCACCTGTGAGG + Intronic
969654907 4:8491358-8491380 CTCCACCTGCTGCCCTGGTGCGG - Intronic
969736223 4:8992846-8992868 CTCCACCTGTGGTTCCTGTGTGG - Intergenic
969755088 4:9143969-9143991 CTCCACCTGCGGCCCCCGTGTGG + Intergenic
969795421 4:9524409-9524431 CTCCACCTGCAGCTCCTGTGCGG - Intergenic
969814995 4:9680252-9680274 CTCCACCTGCGGCCCCCATGTGG + Intergenic
970391287 4:15615326-15615348 CTCCACATGCAACCCCGGTGTGG + Intronic
970615686 4:17766757-17766779 CTCCGCCTGCTGCCCCGGTGCGG - Intronic
970649252 4:18159218-18159240 CTCCACCTGCAGCCCCGGTGCGG - Intergenic
970673093 4:18418285-18418307 CTCCACCTGCAGCCCCGGTGCGG - Intergenic
970803603 4:20004427-20004449 CTCCACCTGCAGCCCCGGTGCGG + Intergenic
970817813 4:20178959-20178981 CTCCACCTGCAGCCCTAGTACGG - Intergenic
971280461 4:25239190-25239212 CTCCACCTGTGGCCCCAGTGTGG - Intronic
971281611 4:25246572-25246594 CTCCACCTGTGGCCCCAGTGTGG - Intronic
971377039 4:26063918-26063940 CTCCACCTGCAGCCCCAGTGCGG - Intergenic
971552969 4:27978283-27978305 CTCCACCTGCAGCCCCAGTGTGG - Intergenic
971563630 4:28113188-28113210 CTCCACCTGCAGCCCAGGTGTGG + Intergenic
971639893 4:29117766-29117788 CTCCACCTGCAGCCCCAGTGCGG + Intergenic
971792279 4:31184917-31184939 CTCCACCTGCAGCCCCGGAGCGG - Intergenic
971812022 4:31439064-31439086 CTCCACCTGCAGCCCCCGTGCGG + Intergenic
972022716 4:34335588-34335610 CTCCACCTGCAGCCCTGGTGTGG - Intergenic
972173450 4:36375383-36375405 CTCCGCCTGCGGCCCCAGTGTGG + Intergenic
972392628 4:38627315-38627337 CTCCACCTGCAGGGGCAGTGCGG + Intergenic
972900197 4:43672770-43672792 TTCCACCTGCAGCCCTGGTGCGG + Intergenic
973037174 4:45420563-45420585 CTCCACCTGCAGCACCTGTGCGG + Intergenic
973045457 4:45530865-45530887 CTCCGCCCGCAGCCCTGGTGCGG + Intergenic
973144196 4:46804778-46804800 CTCCACCTGCGGCCCCGGTAGGG - Intronic
973146395 4:46831460-46831482 CTCCACCTGTGGCCCCAGTGCGG + Intronic
973322833 4:48827794-48827816 CTCCACCTGCAGCCCCGGCATGG + Intronic
973587690 4:52409693-52409715 CTCCACCTGCAGCCCTGGTGCGG - Intergenic
973817656 4:54632948-54632970 CTCCACCTGCAGCCCCAGTGCGG + Intergenic
974128891 4:57729720-57729742 CTCCACCTGCGGCCCAGGTGTGG - Intergenic
974147490 4:57965837-57965859 CTCCACCTGCAGCCCCAGTGCGG + Intergenic
974186859 4:58457341-58457363 CTCCGCCCACAGCCCCAGTGGGG + Intergenic
974590516 4:63942830-63942852 CTCCATCTGCAGCCCAGGTGCGG - Intergenic
974641675 4:64640421-64640443 CTCCACCTGCAGCCCCCATGCGG - Intergenic
974781669 4:66561440-66561462 CTCCACCTACAGCCCTGGTGTGG - Intergenic
974804459 4:66860581-66860603 CTCCACCTGCAGCCCCGGTGCGG + Intergenic
974827830 4:67152292-67152314 CTCCACCTGCAGCCCCTGTGCGG + Intergenic
974892226 4:67896513-67896535 TTCCACCTGCAACCCCAATGGGG - Intergenic
974992802 4:69115188-69115210 CTCCACCTGCGACCCCAGTGTGG - Intronic
975055470 4:69924303-69924325 CTCCACCTGCAGCCCCAGTGTGG + Intergenic
975213945 4:71732150-71732172 CCCAAGCTGCAGCCACTGTGTGG + Intergenic
975298880 4:72766268-72766290 CTCCACCTGCAGACCCCCTGCGG + Intergenic
975595115 4:76043242-76043264 CTCCACCTGCAGCCCTGGTGCGG - Intronic
975596293 4:76050604-76050626 CTCCACCTGCAGCCCTGGTGCGG - Intronic
975755938 4:77571075-77571097 CTCCATCTGCAGCCCCGGTGTGG + Intronic
975994997 4:80303206-80303228 CTCCACCTGCTGCCCCAGTGCGG + Intronic
976102561 4:81580863-81580885 CTCCACCTGCAGCCCCGGTGTGG + Intronic
976350525 4:84055221-84055243 CTCCACATGCAGCACATGTAGGG + Intergenic
976520560 4:86021555-86021577 CTCCACCTGCAGCCCTGGTACGG - Intronic
976646800 4:87395894-87395916 CTCCACCTGCAGCCCCTGTGCGG - Intergenic
976736234 4:88313151-88313173 CTCCACCTGCGGCCCCAGTGCGG - Intergenic
976846131 4:89490417-89490439 CTCTACCTGCAGCCTCCGTGCGG + Intergenic
976980225 4:91217918-91217940 CTCCACCTGCAGCCCCGGTGCGG - Intronic
977206597 4:94170256-94170278 CTCCACCTGCGGCCCCAGTAGGG + Intergenic
977470628 4:97438030-97438052 CTCCACCTGTGGCCCCGGTGCGG - Intronic
977606848 4:98993429-98993451 CTCCACCTGCGGCCCCAGTGCGG - Intergenic
977717278 4:100196468-100196490 CTCCACCTGCAGCCCTGGTTCGG - Intergenic
977750892 4:100608713-100608735 CTCCACCTGCAGCCCCGGTGCGG - Intronic
977791782 4:101113390-101113412 CTCCACACATAGCCCCTGTGAGG - Intronic
977883667 4:102234751-102234773 TTCCACCTGCTGCCCCTGCATGG + Intergenic
978080323 4:104582393-104582415 CTCCATCTGCAGCCCCGGTGCGG + Intergenic
978207125 4:106092347-106092369 CTCCACCTGCGGCCCCAGTGTGG - Intronic
978241814 4:106525292-106525314 CTCCACCTGCAGCCCCAGTGAGG - Intergenic
978285655 4:107073606-107073628 CTCCACCTGCATCCCTGGTGAGG + Intronic
978463552 4:108984339-108984361 CTCCACCTGCAGCCCCTGTGCGG - Intronic
978999507 4:115200142-115200164 CTCTACCTGCAGCCCCAGTGCGG - Intergenic
979290745 4:118976998-118977020 CTCCAGCTGCAGCCCCGGTGCGG - Intronic
979308393 4:119174198-119174220 CTCCACCTGCAGCCCTGGTGCGG + Intronic
979424682 4:120550685-120550707 CTCCACCTGCAACCCCAGTGCGG - Intergenic
979688665 4:123538329-123538351 CTCCACCTGCAGCCCAGGTGCGG + Intergenic
979755938 4:124339424-124339446 CTCTACCTGCAGCCCTGGTGCGG + Intergenic
979822619 4:125192314-125192336 CTCCACCTGCAGCCCCTGTGAGG + Intergenic
979825634 4:125229530-125229552 CTCCACCTGCAGCCCCAGTGCGG - Intergenic
979857443 4:125651711-125651733 CTCCACCTGCACCCCCGGTGTGG - Intergenic
979899634 4:126201239-126201261 CTCCACCTGCAGCCCCGGTGCGG - Intergenic
979991536 4:127380353-127380375 CTCCACCTGCAGCCCTGGTGCGG + Intergenic
980043307 4:127964185-127964207 CTCCACCTGCAGCCCCGGTGCGG - Intronic
980051859 4:128047507-128047529 CTCCACCTGCAGCCCCGCTGCGG - Intergenic
980470156 4:133240355-133240377 CTCCACCTGCAGCCCCGGTGTGG - Intergenic
980628664 4:135407031-135407053 TTCCACCTGCAGCCCCGGTGCGG + Intergenic
980739330 4:136929407-136929429 CTCCACCTGCGGCCCCGGTGTGG + Intergenic
980799833 4:137734148-137734170 CTCCACCTGCGGCCCCAGTGCGG + Intergenic
980815628 4:137942483-137942505 CTCCACCTGCAGCCCCGGTGCGG + Intergenic
980824042 4:138052893-138052915 CTCCACCTGCAGCCCCCTGCGGG - Intergenic
981119874 4:141038130-141038152 CTCCACCTGGAGCCCTTTAGGGG - Intronic
981136269 4:141213959-141213981 CTCCACCCGCGGCCCCAGCGTGG + Intergenic
981146651 4:141332966-141332988 CTCCATCTGCAGCCCCGCTGCGG - Intergenic
981169494 4:141605381-141605403 CTCCACCTGTGGCCCAGGTGTGG - Intergenic
981176519 4:141689806-141689828 CTCCACCTGCAGCCCCAGTGTGG - Intronic
981275886 4:142897910-142897932 CTCCACCTGCAACCCCGGTGTGG + Intergenic
982408298 4:155044715-155044737 CTCCACCTGCAGCCCTGGTGTGG + Intergenic
982728260 4:158928114-158928136 CTCCACCTGCAGCACAGGTGTGG + Intronic
982814509 4:159868980-159869002 CTCCACCTGCAGCCCCGGTGCGG - Intergenic
983026167 4:162739953-162739975 CTCCACCTGCAGCCCTGGTGTGG + Intergenic
983073371 4:163295337-163295359 TTCCAGCAGCTGCCCCTGTGAGG - Intergenic
983135009 4:164068766-164068788 TTCCACCTGCGGCCCTGGTGAGG + Intronic
983230591 4:165125888-165125910 CTCCACCTGCAGCCGCCGTGCGG - Intronic
983552986 4:169035784-169035806 CTCCACCTGCAGCCCGGATGTGG - Intergenic
983752917 4:171298693-171298715 CTCCACCTGCAACCCCGGTGCGG + Intergenic
984069361 4:175092526-175092548 CTCTGCCTGCAGCCCAGGTGCGG + Intergenic
984192760 4:176625112-176625134 CTCCACCTGCATCCCTGGTGCGG - Intergenic
984238746 4:177193144-177193166 CTCCACCTGCAGCCCAGGTGCGG - Intergenic
984265734 4:177496004-177496026 CTCCACCTGCAGCCCCTGTGCGG + Intergenic
984275666 4:177607056-177607078 CTCCACCTGTGGCCCTGGTGCGG - Intergenic
984662320 4:182386962-182386984 CTCCACCTGCAGCCCCTGTGCGG + Intronic
984776036 4:183482636-183482658 CTCCACCTGCAGCCCCGGTGGGG - Intergenic
984901818 4:184592279-184592301 CTCCACCTGCGGCCCTGGTGCGG + Intergenic
984918177 4:184741616-184741638 CTCCGCCTGCAGCCCTGGTGTGG + Intergenic
985195043 4:187420570-187420592 CTCCACCTGCAGCCCCAGTGTGG - Intergenic
985203323 4:187506043-187506065 CTGCACCTGCAGCCCCTGTGCGG + Intergenic
985366472 4:189236718-189236740 CTCCACCTGCAGTCCTTGTGCGG + Intergenic
985403797 4:189616594-189616616 CTCCACCTGCAGCCCCTGTGCGG - Intergenic
985701530 5:1376095-1376117 GGCCACCAGCAGCCACTGTGTGG - Intergenic
986121214 5:4837946-4837968 CTCCACCTGCGGCCCCGGTGTGG + Intergenic
986530151 5:8727442-8727464 CTCCATATGAAGCCCCTGTGTGG + Intergenic
986584141 5:9297352-9297374 CACCACCTGCAGGCCTTGAGAGG - Intronic
986626248 5:9725740-9725762 CTCCACCTGCAGCTCCAGTGCGG + Intergenic
986661827 5:10065916-10065938 CTCCACCTGCGGCCCGGGTGCGG + Intergenic
986698068 5:10375569-10375591 CTCCACCTGCAGCCCGGGTGCGG + Intronic
986963659 5:13244598-13244620 CTCCGCCTGCAGCCCCAGCGTGG + Intergenic
987146179 5:14993752-14993774 CTCCACCTGCAGCCCCGGTGTGG - Intergenic
987156690 5:15096463-15096485 CTCCACCTGCAGCCCTGGTGCGG - Intergenic
987283804 5:16436593-16436615 CTCCACCTGCGGCCCTGGTGCGG + Intergenic
987315363 5:16718364-16718386 CTCCACCTGCAGCCCTGGTGCGG + Intronic
987347371 5:16990929-16990951 CTCCACCTGCGGCCCCAGTGCGG - Intergenic
987355913 5:17062602-17062624 CTCCACCTGCGGCCCTGGTATGG + Intergenic
987476612 5:18399608-18399630 CTCCACCTGCAGCCCCGTGCGGG - Intergenic
987532709 5:19142718-19142740 CTCCACCTGCAGCCCCGGTGCGG - Intergenic
987877019 5:23691537-23691559 CTCCACCTGCAGCCCCAGTGCGG + Intergenic
987896364 5:23951709-23951731 CTCCACCTGCAGCCCCGGTGAGG + Exonic
987990179 5:25199970-25199992 CTCCACCTGCAGCCCCTCTGTGG - Intergenic
988073578 5:26324873-26324895 CTCCACCTGCAGCCCCGGTGCGG + Intergenic
988086916 5:26485228-26485250 GTCCACCTGCAGCCCCCATGCGG - Intergenic
988132232 5:27120312-27120334 CTCCACCTGCAGCCCCGGTGTGG + Intronic
988177342 5:27743873-27743895 CTCCACCTGCAGCCCTGGTGTGG + Intergenic
988201706 5:28077616-28077638 CTCCACCTGTGGCCACCGTGTGG - Intergenic
988279490 5:29127571-29127593 CTCCACCTGCAGCCCCAATGCGG - Intergenic
988291695 5:29296440-29296462 CTCCACCTGCGGCCCCAGTGGGG - Intergenic
988369337 5:30346164-30346186 CTCCACTTGCAGCCCCTGTGCGG + Intergenic
988489075 5:31691961-31691983 CTCCACCTGCAGCCCTGGTGTGG - Intronic
988684666 5:33515336-33515358 CTCCACCTGCAGCCCCTGTGTGG - Intergenic
988915827 5:35892815-35892837 CTCCACCTGCAACCCCAGTGCGG - Intergenic
989003274 5:36782993-36783015 CTCCACCTGCAGCCCCGGTGTGG + Intergenic
989346866 5:40439072-40439094 CTCCACCTGCAGCCCCGGTGCGG + Intergenic
989956920 5:50369850-50369872 CTCCACCTGCAGCCCCGGTGTGG + Intergenic
990345341 5:54865489-54865511 CTCCACCGGCAGCGCGGGTGTGG + Intergenic
990461593 5:56035902-56035924 CTCCACCTGCAGCCCTGGTGCGG + Intergenic
990490136 5:56295737-56295759 CTCCACCTGCAGCCCCTGTGAGG + Intergenic
990880291 5:60530710-60530732 CTCCACCTGCGGCCCCCGTGCGG + Intergenic
991003327 5:61804635-61804657 CTCCATCTGCAGGCCATCTGGGG + Intergenic
991330166 5:65485426-65485448 CTCCACCTGCAGCCCCGGTGCGG - Intergenic
992947519 5:81824126-81824148 CTCCACCTGCAGCCCTGGTGCGG + Intergenic
993031945 5:82715102-82715124 CTCCACCTGCAGCCCCAGTGCGG + Intergenic
993320862 5:86466629-86466651 CTCCACCTGCAGCCCCGGTGTGG - Intergenic
993328498 5:86569469-86569491 CTCCACCTGCAGCCCCCGTGCGG - Intergenic
993529116 5:89003572-89003594 CTCCACCTGCGACCCCGGTGCGG - Intergenic
993678535 5:90847465-90847487 CTCCACCTGCAGCCCTGGTGCGG - Intronic
993803468 5:92374841-92374863 CTCCACCTGCAGCCCCAGTGTGG - Intergenic
993822112 5:92631744-92631766 CTCCACCTGCAGCCCCAGTGTGG + Intergenic
993952304 5:94191837-94191859 CTCCACTTGGATCCCCAGTGGGG - Intronic
994096415 5:95851579-95851601 TTCCACCTGCAGCCCAGGTGCGG + Intergenic
994254723 5:97579942-97579964 CTCCACCTGCAGCCCCGGTGCGG - Intergenic
994509769 5:100688815-100688837 CTCCACCTGCAGCCCCCGTGCGG - Intergenic
994605533 5:101962393-101962415 CTGCACCTGCAGCCCCTGTGCGG - Intergenic
994647692 5:102491339-102491361 CTCCACCTGCGGCCCCGGTAGGG - Intronic
994701631 5:103141982-103142004 CTCCACCTGCAGCCCTGGTGCGG - Intronic
994841465 5:104929414-104929436 CTCTACCTGTGGCCCCGGTGCGG + Intergenic
994928875 5:106154670-106154692 CTCCACCTACAGCCCCTGTGCGG + Intergenic
994935349 5:106246623-106246645 CTCCACCTGCAGCCCCGGTGCGG + Intergenic
995032379 5:107494608-107494630 CTCCATCTGCAGCCCCGTTGGGG + Intronic
995112312 5:108442029-108442051 CTCCACCTGTGGCCCCGGTATGG - Intergenic
995326349 5:110893975-110893997 CTCCACCTGCAGCCCCCGTGCGG - Intergenic
995388261 5:111612099-111612121 CTCCACCTGCAGCCCTGGTGCGG - Intergenic
995679799 5:114704236-114704258 CTCCACCTGCAGCCCCAGTGCGG - Intergenic
995700470 5:114929320-114929342 CTCCACCTGCAGCCCCGGTGTGG + Intergenic
995920468 5:117305075-117305097 CTCCACCTGCAGCCCAGGTGCGG + Intergenic
995975901 5:118034238-118034260 CTCCACCTGCGGTCCCAGTGTGG + Intergenic
996107115 5:119517517-119517539 CTCCACCTGCAGCCCTGGTGTGG + Intronic
996234292 5:121107589-121107611 CTCCACCTGCAGCCCCGCTGCGG + Intergenic
996435770 5:123430967-123430989 CTCCACCTGCAGCCCCGGTGCGG + Intergenic
996478628 5:123949137-123949159 CTCCACCTGCGGCCCCAGTGCGG - Intergenic
996575821 5:124976066-124976088 CTCCACCCGTGGCCCCAGTGTGG - Intergenic
997760634 5:136444627-136444649 CTCCACCTGCAGCCCCGGTGCGG + Intergenic
998142717 5:139709281-139709303 CTCCACCTGCCTCCCCGGGGAGG - Intergenic
998441876 5:142169440-142169462 CTCCAGCCACAACCCCTGTGGGG - Intergenic
999406255 5:151309605-151309627 CTCCACCTGCATCCCCGGTGTGG + Intergenic
999710631 5:154315341-154315363 CTCCACCTCCTTCCCCTGCGGGG - Intronic
999855211 5:155586700-155586722 CTCCACCTGCAGCCCCCGTGCGG - Intergenic
1000066107 5:157694251-157694273 CTCCACCTGCAGCCCCAGTGTGG + Intergenic
1000084818 5:157879690-157879712 CTCCACCTGCGGCCTCGGTGTGG + Intergenic
1000212424 5:159119543-159119565 CTCCACCTGTGGCCCTGGTGCGG + Intergenic
1000329116 5:160193844-160193866 CTCCACCTGCAACCCTGGTGCGG - Intronic
1000432304 5:161166105-161166127 CTCCACCTGCGACCCCTGTGTGG - Intergenic
1000547683 5:162622257-162622279 CTCCACCTGTGGCCCCAGTGCGG + Intergenic
1001425409 5:171619238-171619260 CTCCACCCCCAGCCCCAGGGAGG + Intergenic
1001602820 5:172940031-172940053 CTTCATCTGCAGCCCCTCTAAGG - Intronic
1001670516 5:173469586-173469608 TTCCACCTGCAGCCCTTCTCGGG + Intergenic
1002004564 5:176221973-176221995 CTCCACCTGCAGCCCCGGTGCGG - Intergenic
1002221811 5:177688647-177688669 CTCCACCTGCAGCCCCAGTGCGG + Intergenic
1002560291 5:180077020-180077042 CTTCACCTACAGCATCTGTGAGG - Intergenic
1002617431 5:180464427-180464449 CTCCACCTGGAGCCCCCCTGTGG + Intergenic
1002772785 6:303837-303859 CTCCACCTCCAGCCCCCGCATGG - Intronic
1002789307 6:426148-426170 CTCCGCCTGCAGCCCCGGTGCGG - Intergenic
1002817777 6:694994-695016 CTCCACCTGCGGCCCCGGTCGGG + Intergenic
1002897528 6:1388351-1388373 CTCCCCCTTCAGCCCTTGGGAGG + Intergenic
1002906955 6:1456918-1456940 CTCCACCTGCAGCCCCGGTAGGG - Intergenic
1002935762 6:1671028-1671050 CTCCCCTTGCAGCGACTGTGGGG + Intronic
1002946228 6:1763871-1763893 CTCCACCTGTGCCCCCAGTGTGG - Intronic
1003060795 6:2860553-2860575 CTCCACCTGCACCCCCAGTGTGG + Intergenic
1003170781 6:3720713-3720735 CTCCACCTGCAGCCCCAGTGTGG - Intergenic
1003213808 6:4090503-4090525 CGCCACCTGCGGCCCCGGTATGG + Intronic
1003284781 6:4725277-4725299 CTCCACCTGCACCCTCGGTGCGG - Intronic
1003506614 6:6745664-6745686 CTCCACTTGCGGCCCCGGTGTGG - Intergenic
1003578098 6:7315588-7315610 CTCCACCTGCAGCCCCAGTACGG + Intronic
1003578251 6:7316771-7316793 CTCCACCTGCAGCCCCGGTGTGG - Intronic
1003589667 6:7426150-7426172 CTCCACTTGCGGCCCCAGTGCGG + Intergenic
1003591681 6:7441628-7441650 CTCTACCTGCGGCCCCGCTGGGG + Intergenic
1003593777 6:7456732-7456754 CTCCCCCTGCGGCCCGGGTGCGG + Intergenic
1003717774 6:8666381-8666403 CTCCACCTGCAGCCCCGGTGTGG + Intergenic
1003736968 6:8887578-8887600 CTCCACCTGCAGCCCCGGTGCGG + Intergenic
1003748084 6:9024679-9024701 CTCCACCTGCAGCCCCCGTGCGG + Intergenic
1003770078 6:9290391-9290413 CTCCACCTGCAGCCCCTGTGCGG - Intergenic
1003836142 6:10074658-10074680 CTCCACCTGCGGCTCTGGTGCGG - Intronic
1003845805 6:10172167-10172189 CTCCACCTGCAGCCCAGGTGCGG + Intronic
1003862864 6:10337824-10337846 CTCCACCTGCAGCCCCGGTGCGG + Intergenic
1003896952 6:10617007-10617029 CTCCACCTGCGGCCCTGGTGCGG - Intronic
1003901664 6:10660302-10660324 CTCCACCTGCGGCCCCAGTGCGG + Intergenic
1003908202 6:10721002-10721024 CTCCACCTGCAGCCCTGGTGTGG + Intergenic
1003982396 6:11402529-11402551 CTCCAGCTGCAACCCCTGTCTGG - Intergenic
1004037042 6:11933494-11933516 CTCCACCTGCAGCCCCGGTGCGG + Intergenic
1004045296 6:12017879-12017901 CTCCACCTGTGGCCCCAGTGCGG - Intronic
1004196510 6:13510983-13511005 CTCCACCTGCGACCCTGGTGGGG - Intergenic
1004224464 6:13772902-13772924 CTCTACCTGCAGCACCTATGCGG + Intergenic
1004248513 6:14002801-14002823 CTCCACCTGCAGCCCCACTGGGG + Intergenic
1004338151 6:14783551-14783573 CTCCACCTGCGGCCCAGGTGTGG - Intergenic
1004486203 6:16069148-16069170 CTCCACCTGCAGCCCCTGTGCGG - Intergenic
1004503118 6:16226816-16226838 CTCCACCTGCAGCCCCAGTGCGG - Intergenic
1004511721 6:16288668-16288690 CTCCATCTGCAGCCCCAGTGCGG + Intronic
1004526145 6:16409860-16409882 CTCCACCTGCTGGCCTTCTGGGG + Intronic
1004665463 6:17745255-17745277 CTCCACCTGCAGCTCCGGTGCGG - Intergenic
1004689023 6:17976142-17976164 CTCCACCTGCAGCCCCGGTGCGG - Intronic
1004694256 6:18019624-18019646 CTGCACCTGCGGCCCCGGTGCGG - Intergenic
1004861317 6:19806958-19806980 CTCCACCTGCGGCCCCAGTGCGG - Intergenic
1004865981 6:19854381-19854403 CTCCGCCTGCAGCCCCGGTGCGG - Intergenic
1004906866 6:20244718-20244740 CTCCACCTGGAGCCCTGGTGCGG - Intergenic
1005035499 6:21552230-21552252 CTCCACCTGCAGCCCCGGTGCGG - Intergenic
1005042199 6:21609847-21609869 CTCCACCTGCAGCCCTGGTGTGG - Intergenic
1005332808 6:24765883-24765905 CTCCACCTGCAGCCCCGGCGCGG - Intergenic
1005561501 6:27045646-27045668 CTCCACCTGCGGCCCCAGTGCGG + Intergenic
1005596137 6:27381015-27381037 CTCCACTTGCAGCCCTGGTGCGG - Intronic
1005600796 6:27424775-27424797 CTCCACCTGCAGCCCCAGCGCGG - Intergenic
1005707379 6:28469301-28469323 CTCCACCTGCAGCCCCAGTGCGG - Intergenic
1005724994 6:28639732-28639754 CTCCACCTGCATCCCTGGTGCGG - Intergenic
1005749852 6:28872539-28872561 CTCCACCTGCAGCCCCAGTGCGG - Intergenic
1005758822 6:28949741-28949763 CTCCACCTGCAACCCCGGTGCGG - Intergenic
1005976937 6:30807389-30807411 CTCCACCTGCAGCCCCAGTGTGG - Intergenic
1006005846 6:31000878-31000900 CTCCACCTGCAGCCCCGGTGCGG + Intergenic
1006007892 6:31017211-31017233 CTCCATCTGCGGCCCAGGTGCGG + Intronic
1006008383 6:31021133-31021155 CTCCACCTGCGGCCCCGGGGCGG + Intronic
1006033707 6:31195874-31195896 CTCCACCTGCAGCCCCGGTGCGG + Intergenic
1006128023 6:31852428-31852450 CTCCACCTGCGGCCCCAGTGCGG + Intergenic
1006226997 6:32547871-32547893 CTCCACCTGCAGCCCTGGTGCGG - Intergenic
1006352714 6:33532803-33532825 CTCCACCTGCAGCCCCAGTGCGG + Intergenic
1006477904 6:34269439-34269461 CTCCACCTGCAGCCCCGGTGCGG + Intergenic
1006696080 6:35931683-35931705 CTCCACCTGCAGCCCCAGTGCGG + Intergenic
1006978291 6:38124276-38124298 CTCCACCTGCGGCTCCAGTGCGG - Intronic
1007074144 6:39056213-39056235 ATCCACCTGGGGCCCCTGGGTGG + Intronic
1007301601 6:40871926-40871948 CACCCCATGCAGGCCCTGTGGGG + Intergenic
1008254139 6:49275856-49275878 CTCCACCTGCAGCCCCGGTGTGG + Intergenic
1008270115 6:49481774-49481796 CTCCACCTGCAGCCCCAGTGTGG - Intronic
1008270424 6:49483369-49483391 CTCCACCTGCAGCCCCAGTGTGG - Intronic
1008284266 6:49629496-49629518 CTCCACCTGCATGCCTGGTGCGG - Intronic
1008567896 6:52786897-52786919 CTCCACCTGCAGCCCCGGTGTGG + Intergenic
1008771069 6:54979649-54979671 CTCCACCTGCAGCCCTGGTGCGG + Intergenic
1009470339 6:64024147-64024169 CTCCACCTGCAGCCCTGGTGCGG + Intronic
1009510740 6:64547673-64547695 CTCCACCTGCAGCCCCAGTATGG - Intronic
1009587718 6:65627954-65627976 CTCCACCTGCAGCCCCGGTGCGG + Intronic
1009685413 6:66949628-66949650 CTCCACCTGCAGCCCCGTGCGGG + Intergenic
1009739349 6:67723464-67723486 CTCCACCTGTGGCCCTGGTGTGG + Intergenic
1009872340 6:69467623-69467645 CTCCACCTGCGGCCCTGGTGTGG + Intergenic
1010235573 6:73572479-73572501 CTCCACCTGCCCCCCCAGTGCGG - Intergenic
1010617456 6:78030215-78030237 CTCCACCTGCAGCCCCGGTGCGG + Intergenic
1011143763 6:84189781-84189803 CTCCACCTGCAGCCCCGGTGCGG + Intronic
1011178182 6:84587804-84587826 CTCCACCTGCAGCCCCAATGCGG + Intergenic
1011246591 6:85326381-85326403 CTCCACCTGCAGCCCTGGTGCGG + Intergenic
1011518685 6:88180660-88180682 CTGCCCCTGAAGCCCCTTTGGGG - Intergenic
1011601657 6:89065326-89065348 CTCCACCTACAGCCCCGGTGCGG + Intergenic
1011618644 6:89221316-89221338 GAGCACCTGCAGCCCCTGTTTGG - Intronic
1011787372 6:90862193-90862215 CTCCACCTGGTGCCCCTGACAGG - Intergenic
1011870013 6:91881841-91881863 CTCCACCTGCAGCCCGGGTGCGG - Intergenic
1011974831 6:93283018-93283040 CTCCACCTGCGGCCCCGGTGCGG + Intronic
1012189270 6:96260893-96260915 CTCCACCTGCGGCCCCTGTGTGG - Intergenic
1012578159 6:100829179-100829201 CTCCACCTGCAGCCCAGGTGCGG - Intronic
1012733488 6:102910667-102910689 CTCTACCTGCGGCCCCAGTGTGG - Intergenic
1012760430 6:103294351-103294373 CTCCACCTGCAGCCCCGGTGCGG - Intergenic
1012939885 6:105404388-105404410 CTCCTCCTTCTGCCACTGTGAGG + Intergenic
1013080298 6:106806169-106806191 CTCCACCTGCAGCCCCGGTGCGG + Intergenic
1013081412 6:106816709-106816731 CTCCACCTGCAGCCCTGGTGCGG - Intergenic
1013143495 6:107364192-107364214 CTCCACCTGCAGCCCCAGTGCGG - Intronic
1013694737 6:112689314-112689336 CTCCACTTGCAGCCCCGGTGCGG - Intergenic
1013963379 6:115928029-115928051 CTCCACCTGCAGCCCTGGTGCGG - Intergenic
1014240815 6:119015737-119015759 CTCCACCTGCAGCCCCGGTGCGG + Intronic
1014460197 6:121686402-121686424 CTCCACCTGCAGCCCCAGTGCGG - Intergenic
1014499209 6:122165075-122165097 CTCCACCTGCGGCCCCGGTGTGG - Intergenic
1014507833 6:122280993-122281015 CTCCACCTGTAGCCCAGGTGCGG + Intergenic
1014718630 6:124892386-124892408 CTCCACCTGCAGCCCTAGTGCGG + Intergenic
1014739075 6:125126267-125126289 CTCCACCTGCAGCCCCAGTGCGG + Intronic
1014970830 6:127813195-127813217 CTCCAACTGCAGTCCTGGTGTGG + Exonic
1015150208 6:130029261-130029283 CTCCCACTGTAGCCCCTTTGGGG + Intronic
1015492145 6:133838167-133838189 CTCCACCTGGAGGCCCTATCTGG + Intergenic
1015572178 6:134633491-134633513 CTCCACCCGTGGCCCCGGTGCGG - Intergenic
1015582142 6:134737115-134737137 CACCTCCTGCAGCACCTATGGGG + Intergenic
1015600419 6:134905143-134905165 CTCCACCTGCAGCCCTGGTGCGG + Intergenic
1016069823 6:139726283-139726305 CTCCACCTGCAGCCCCGGTGAGG - Intergenic
1016092756 6:139999531-139999553 CTCCACCTGCAGCTCCAGTGCGG - Intergenic
1016482242 6:144495097-144495119 CTCCACCTGCAGCCCGGGTGCGG - Intronic
1016858727 6:148697140-148697162 CTCCACCTGTGGCCCCGGTGGGG - Intergenic
1016987331 6:149905265-149905287 CTCACCCTGCAGCACCTGTGGGG + Intergenic
1017008179 6:150043340-150043362 CTCCTCCAGCTGCCCCAGTGAGG + Intergenic
1017299052 6:152834757-152834779 CTCCACCTGCAGCCCCGGTGCGG + Intergenic
1017325165 6:153134035-153134057 CTCCACCTGCAGCCCCAGTACGG + Intergenic
1017537447 6:155363484-155363506 CTCCACTTGCAGCCCTGGTGCGG + Intergenic
1017581143 6:155866702-155866724 CTCCACCTGCAGCCCCGGTGCGG - Intergenic
1017771578 6:157648892-157648914 CCCCACCTGCAGTGCGTGTGTGG + Intronic
1017839422 6:158209698-158209720 CTCCACCTGCAGCCCCGGTGCGG - Intergenic
1017931466 6:158959118-158959140 CTCCACTAGCAGCCCTGGTGGGG + Intergenic
1018064164 6:160114464-160114486 CTCCACCTGCAGCCCCGGTGTGG - Intergenic
1018545740 6:164933710-164933732 CTCCACCTGCAGCCCGGGTGCGG + Intergenic
1018573309 6:165233230-165233252 CCCCAGCTGCAGCCCCTGGCTGG - Intergenic
1018624575 6:165765234-165765256 CTCCACCTGCAGCCCCCGTGCGG - Intronic
1018876787 6:167827616-167827638 CTCCACCTGCAGCCCGGTTGTGG + Intronic
1018919963 6:168165584-168165606 CTCCTCCTGCCGCTCCTGTGAGG + Intergenic
1019000192 6:168743731-168743753 CTCCACCTGCAGCCCCGGTGCGG - Intergenic
1019505553 7:1388782-1388804 GTCCAGCTGGAGACCCTGTGAGG + Intergenic
1019688869 7:2398520-2398542 CGGCACCTGCAGCCCCTCTCTGG + Intergenic
1019944192 7:4313884-4313906 CTCCACCTGCAGCCCCTGTGCGG - Intergenic
1019965681 7:4496877-4496899 CTCCACCTGCAGCCCCTGTGCGG - Intergenic
1020070391 7:5223432-5223454 GTGCACCTGCTGCACCTGTGGGG - Intronic
1020163985 7:5793906-5793928 CTCCACCTGCGGCCCCAGTGCGG + Intergenic
1020784361 7:12556109-12556131 CTCCACCTGCAGCCCCAGTGTGG - Intergenic
1021133945 7:16943399-16943421 CTCCGTCTGCGGCCCCAGTGCGG + Intergenic
1021324196 7:19245897-19245919 CTCCACCTGCAGCCCAGGTGCGG + Intergenic
1021359335 7:19692198-19692220 CTCTGCCCGCGGCCCCTGTGTGG - Intergenic
1021520641 7:21536536-21536558 CTCCACGTGCGGCCCCGGTGTGG - Intergenic
1021567823 7:22032314-22032336 CTCCACCTGCGGCCCCAGTGCGG - Intergenic
1021686693 7:23193679-23193701 CTCCACCTGTGGCCCTGGTGTGG - Intronic
1023128007 7:36974151-36974173 CTCCACCTGCAGCCCCGGTGTGG + Intronic
1023270115 7:38453399-38453421 TTCCAGCTGCAGCTCCTGTGAGG - Intronic
1024269150 7:47628890-47628912 CTCCACCTGCAGCCCCGGTGCGG + Intergenic
1024335561 7:48202860-48202882 CTCCACCTGCAGCCCTGGTGCGG - Intronic
1024465977 7:49711670-49711692 CTCCACCTGCAGCCCCAGTGTGG + Intergenic
1024511960 7:50211761-50211783 CTCCTCCTGATGCCACTGTGTGG - Intergenic
1024735742 7:52302841-52302863 CTCCACCTGTGGCCCTTGTGCGG - Intergenic
1024741839 7:52363020-52363042 CTCCACCTGCAGCCCAGGTGCGG + Intergenic
1024748130 7:52431189-52431211 CTCCGCCTGCGGCCCCGGCGCGG - Intergenic
1024825357 7:53385108-53385130 CTCCACCTGCAGCCCTGGTGCGG - Intergenic
1024834118 7:53495434-53495456 CTCCACCTGCAGCCCCAGTGCGG + Intergenic
1025256759 7:57389075-57389097 CTCCAGCTCCTTCCCCTGTGTGG + Intergenic
1025962006 7:66231308-66231330 CTCCACATGCAGCCCCGGTGCGG - Intronic
1026187022 7:68090361-68090383 CTCCACCTGCAGCCCCGTTGTGG - Intergenic
1026335964 7:69394239-69394261 CTCCACCTGCAGCCCCGGTGCGG + Intergenic
1026516639 7:71078400-71078422 CTCCACCTGCAGCCCCGGTGTGG + Intergenic
1026596486 7:71738026-71738048 CTCTACCTGCAGCCCTGGTGTGG - Intergenic
1026960838 7:74406075-74406097 CTTCAGCTCCAGCCCCTCTGAGG - Intergenic
1027561746 7:79739714-79739736 CTCCACCTGCAGCCCCGGTGCGG + Intergenic
1027563970 7:79767912-79767934 CTCCACCTGCAGCCCCGATGCGG - Intergenic
1027667465 7:81057430-81057452 CTCCACCTGCAGCCCTGGTGCGG - Intergenic
1027674549 7:81142151-81142173 CTCCACCTGCGGCCCCGGTGCGG + Intergenic
1027698212 7:81437037-81437059 CTCCACCTGTAGCCCCAGTGCGG - Intergenic
1027779020 7:82499983-82500005 CTCCACCTGCAGCCCCAGTGTGG + Intergenic
1027868169 7:83673724-83673746 CTCCACCTGCAGCCCCAGTGCGG + Intergenic
1028511145 7:91627340-91627362 CTCCACCTGCAGCTCTGGTGCGG - Intergenic
1028778394 7:94705906-94705928 CTCCACCTGCAGCCCCGGTGCGG + Intergenic
1028852446 7:95552413-95552435 CTCCACCTGCAGCCCCGGTGTGG - Intergenic
1028913063 7:96229121-96229143 CTCCGCCCGCAGCCCCAGTGCGG + Intronic
1029076209 7:97936295-97936317 CTCCACCTGCAGCTCCTGTGCGG + Intergenic
1029567577 7:101348988-101349010 CTCCACCTGCAGCCCCGGTGTGG + Intergenic
1029904025 7:104072173-104072195 CTCCACCTGCAGCCCCAGTGCGG + Intergenic
1030188170 7:106784364-106784386 CTCCTCCTGCCCCCCATGTGAGG + Intergenic
1030215660 7:107042309-107042331 CTCCACCTGCAGCCCCAGTGCGG - Intergenic
1030316966 7:108125978-108126000 CTCCTCCTGCTGCTCCTTTGGGG - Intronic
1030497979 7:110323642-110323664 CTCCTGCTTCAGCCCTTGTGGGG + Intergenic
1030733560 7:113017759-113017781 CTCCACCTGCAGCCCCGGTGCGG + Intergenic
1030772150 7:113488082-113488104 CTCCACCCGCAGCCCCAGCAGGG - Intergenic
1030780485 7:113593731-113593753 CTCCACCTGCAGTCCCGGTGCGG + Intergenic
1030980623 7:116181930-116181952 CTCCGCCTGCAGCCCCAGTGCGG - Intergenic
1031056466 7:116997944-116997966 CTCCACCTGCAGCCCCAGTGCGG - Intronic
1031110034 7:117596522-117596544 CTCCACCTGCAGCCCCAGTGCGG + Intronic
1031292191 7:119951458-119951480 CTCCACCTGCACCCCCAGTGTGG - Intergenic
1031409280 7:121422140-121422162 CTCCACCTGTGGCCCCAGTGCGG + Intergenic
1031513221 7:122673762-122673784 CTCTGCCTGCAGCCCTGGTGTGG - Intronic
1032248140 7:130230435-130230457 CTCCACCTGCAGCCCCTGTGCGG + Intergenic
1032339720 7:131059174-131059196 CTCCGCCTGCATCCCCAGTGTGG + Intergenic
1032561533 7:132898554-132898576 CTCCACCTGCAGCCTGGGTGCGG - Intronic
1033312361 7:140271292-140271314 CTCCACCTGCGACCCGGGTGCGG - Intergenic
1033664032 7:143424345-143424367 CTCCACCTACAGCCCTGGTGCGG - Intergenic
1033758545 7:144417917-144417939 CTCCACCTGCGGCCCTGGTGCGG - Intergenic
1033779393 7:144650837-144650859 CTCCACTTGCAGCCCCGGTGCGG + Intronic
1033866576 7:145697360-145697382 CTCCACCTGCGGCCCCGGTGCGG - Intergenic
1034091117 7:148364221-148364243 CTCCACCTGCAGCCCCAGTGCGG + Intronic
1034097985 7:148426821-148426843 CTCCACCTGCAGCCCCAGTGCGG + Intergenic
1034155089 7:148949494-148949516 CTCCACCTGCAGCCCCGGTGCGG + Intergenic
1034167686 7:149038646-149038668 CTCCACCTGCAGCCCCGGTGTGG - Intergenic
1034275884 7:149823716-149823738 CTGCTCCAGCAGCCCCTGGGTGG - Intergenic
1034441786 7:151089354-151089376 CTCCACCCCCAGCCCCAGGGCGG + Intronic
1034547193 7:151796831-151796853 CGCCACCTCCAGCCCCTGTACGG + Intronic
1034632071 7:152538835-152538857 CTCCACCTGCAGCCCCGGTGCGG - Intergenic
1034655967 7:152730223-152730245 CTCCACCTGCAGCCCCGGTGCGG - Intergenic
1034967492 7:155400219-155400241 CTCCACCTGCAGCACGGATGTGG - Intergenic
1035151116 7:156873953-156873975 CTCCACCTGCAGCCCTAGTGCGG - Intronic
1035192233 7:157180947-157180969 CTCCACCTGGGGCCCCGGGGTGG - Intronic
1035373844 7:158395230-158395252 CTCGACCTGAATCCCCCGTGCGG + Intronic
1035492689 7:159294151-159294173 CTCTCTCTGCAGCCGCTGTGAGG + Intergenic
1035537600 8:404300-404322 CACCACCCTAAGCCCCTGTGAGG + Intergenic
1035663757 8:1365306-1365328 GGCCACCTGCAGCCTCGGTGCGG - Intergenic
1035999311 8:4583241-4583263 CTCCACCTGCAGCCGTGGTGCGG + Intronic
1036123757 8:6045008-6045030 CTCCACCTGCAGCCTCCGTGTGG - Intergenic
1036378330 8:8219285-8219307 CTCCACCTGCGACCCCCGTGTGG + Intergenic
1036440958 8:8781339-8781361 CTCCACCTGCAGCCCCGGTGCGG - Intergenic
1036554594 8:9847747-9847769 CTCCATCTGCGGCCCTGGTGCGG - Intergenic
1036831421 8:12023015-12023037 CTCCACCTGCGGCTCTTGTGCGG + Intergenic
1036901644 8:12673818-12673840 CTCCACCTGTGGCTCCTGTGTGG + Intergenic
1037239434 8:16760488-16760510 CTCCTCCTGCAGCCCTGGTGTGG - Intergenic
1037241623 8:16784319-16784341 CTCCACCTGCAGCCCCGGTGTGG + Intergenic
1037263774 8:17036765-17036787 CTCCACCTGCAGCCCTGGTGCGG - Intronic
1037425540 8:18750991-18751013 CTCCACCTGCAGCCCCGGTGCGG - Intronic
1037496268 8:19443872-19443894 CTCCACCCCCACCCCCAGTGTGG - Intronic
1037811054 8:22086981-22087003 CTCCACCTGCAGCCCCGGTGCGG + Intergenic
1037957477 8:23070728-23070750 CTCCACCTGCAACCCCGGTGCGG - Intergenic
1037971269 8:23173746-23173768 CTCCACCTGCAGCCCCAGTGCGG - Intergenic
1037983597 8:23272529-23272551 CTCCACCTGCAGCCCCCGTGCGG + Intronic
1038174137 8:25164908-25164930 CTCCACCTGCAGCCCCGGTGCGG + Intergenic
1038406280 8:27325247-27325269 CTCCACCTGCAGCCTTTTGGAGG - Intronic
1038420202 8:27429727-27429749 CTTCACCTGCAGGTCCTGGGGGG - Intronic
1038639475 8:29311875-29311897 GCTCCCCTGCAGCCCCTGTGCGG + Intergenic
1039061369 8:33574316-33574338 CTCCACCTGCAGCCCCTGTGCGG + Intergenic
1039069037 8:33633775-33633797 CTCCACCTGCAGCCGCAGTGCGG - Intergenic
1039615350 8:38950999-38951021 CTCCCCCCGCAGCCCCAGTCAGG - Intronic
1039637375 8:39180540-39180562 CTCCACCTGCAGCCCTGGTGCGG + Intronic
1039838397 8:41276147-41276169 TTCCACCTGGAGGCTCTGTGGGG - Intronic
1040003622 8:42600004-42600026 CTCCGCCTGCAGCCCTGGCGTGG - Intergenic
1040014548 8:42689925-42689947 CTCCACCTGCAGCCCTGGTGTGG + Intergenic
1040026613 8:42787168-42787190 CTCCACCTGCGGCCCTGGTGCGG + Intronic
1040324019 8:46332102-46332124 CTCCACCTGCAGCTCTGGTGTGG + Intergenic
1040723196 8:50350331-50350353 CTCCACCTGTGGCCCTGGTGCGG + Intronic
1040952640 8:52952804-52952826 CTCCACCTGCAGCCCTGGTGCGG - Intergenic
1041034592 8:53775848-53775870 CTCCACCTGCAGCCCCAGTGCGG - Intronic
1041600996 8:59717301-59717323 CTCCCACTGCAGCCCCTGCATGG + Intergenic
1041914591 8:63126487-63126509 CTCCACCTGCAGCCCCGGTGCGG + Intergenic
1041918998 8:63162402-63162424 CTCCACCTGCAGCCCTGGTGCGG + Intergenic
1042336092 8:67631129-67631151 CTCCACCCGTGGCCCCGGTGTGG + Intronic
1042465881 8:69129667-69129689 CTCCCGCTGCAGGCCCTGCGCGG - Intergenic
1042512502 8:69626432-69626454 CTCCACCTGCAGCCCCTGTGCGG - Intronic
1042948685 8:74179479-74179501 CTCCGCCTCCGGCCCCTGTGCGG - Intergenic
1043073272 8:75665413-75665435 CTCCACCTGCGGCCCCGGTGCGG - Intergenic
1043129866 8:76447563-76447585 CTCCACCTGCAGTCCCCGTGCGG - Intergenic
1043346530 8:79303907-79303929 CTCCACCTGCAGCCCGGGAGCGG + Intergenic
1043352422 8:79377151-79377173 CTCCACCTGCTGCCCCGGTGCGG - Intergenic
1043435396 8:80232221-80232243 CTCCACCTGCAGGCCCGGTGCGG + Intergenic
1043477013 8:80615128-80615150 CTTCTCCTGTAGCCCATGTGAGG - Intergenic
1043640232 8:82441791-82441813 CTCCACCTGCAGCCCCGGTAAGG + Intergenic
1043709954 8:83403359-83403381 CTCCACCTGCAGCCCCGGTGTGG + Intergenic
1043731881 8:83693945-83693967 CTCCACCTGTGGCCCCAGTATGG - Intergenic
1043912817 8:85883271-85883293 CTCCATCATCAGCCCCAGTGAGG + Intergenic
1044404954 8:91816734-91816756 CTCCACCTGCAGCCCAGGTGCGG + Intergenic
1044633404 8:94300281-94300303 CTCCACCTGCTGCCCCGGTGTGG - Intergenic
1044788757 8:95824052-95824074 CTCCATCTGTAGCCCTGGTGCGG + Intergenic
1044880600 8:96719034-96719056 CTCCACCTGCAGCCCCGGTGCGG - Intronic
1045131875 8:99163347-99163369 CTCCACCTGCAGCCCCGGTGCGG - Intronic
1045232259 8:100316720-100316742 CTCCAACTGCAGCCCTGGTGCGG - Intronic
1045467691 8:102485461-102485483 CTCCACCTGCAGCCCTGGTGCGG - Intergenic
1046265325 8:111823238-111823260 CTCCACCTGCAGCTCCAGTGCGG - Intergenic
1046284985 8:112082967-112082989 CTCCACCTGCAGCCCCCTTGCGG - Intergenic
1046288978 8:112133105-112133127 CTCCACTTGCAGCCCTGGTGCGG + Intergenic
1046445410 8:114311763-114311785 CTCCACCTGCAGCCCTGGTGCGG + Intergenic
1046450779 8:114386568-114386590 CTCCACCTGCAGCCCTGGTGCGG + Intergenic
1046521326 8:115330514-115330536 CTCCTCCCGTGGCCCCTGTGTGG - Intergenic
1046621277 8:116531457-116531479 CTCCACCTGCAGGCCCCGTGCGG + Intergenic
1046802401 8:118442942-118442964 CTCCACCTGAAGCCCAGCTGAGG - Intronic
1047631633 8:126714585-126714607 CTCCACCTGTGGCCCCAGTGCGG - Intergenic
1047925125 8:129675389-129675411 TCTCACCTACAGCCCCTGTGGGG + Intergenic
1047982356 8:130196424-130196446 CTCCACCTGCAGGCCCATAGAGG - Intronic
1048503182 8:134997113-134997135 CTCATCCTGCAGGCCATGTGGGG + Intergenic
1048517058 8:135120743-135120765 CTCCACCGCCAGGCCCAGTGGGG - Intergenic
1048575971 8:135690405-135690427 CTCCACCTGCAGCCCCAGTGTGG - Intergenic
1048757427 8:137755067-137755089 CTCTACCTGCAGCCCTGGTGTGG - Intergenic
1049001861 8:139831378-139831400 CTCTTCCTGTAGCCCCTGTTAGG - Intronic
1049087566 8:140490464-140490486 CTCCGCCTGCAGCCCCAGTGTGG - Intergenic
1049157761 8:141077053-141077075 CTCCACCTGCAGCCCCGGTGCGG + Intergenic
1049463615 8:142741220-142741242 CTCCTGCTCCAGCTCCTGTGTGG - Exonic
1049500383 8:142959889-142959911 CTGCACCTGCAGCCCCGGTGCGG + Intergenic
1049857993 8:144875540-144875562 CTCCACCTGTGGCCCTGGTGTGG + Intergenic
1049944442 9:580719-580741 CTCCGCCTGCGGCCCCAGTGCGG - Intronic
1050975194 9:11928850-11928872 CTCCACCTGTGGCCCCGGTGTGG - Intergenic
1051305017 9:15699992-15700014 CTCCACCTGCAGCCCGGGTGCGG - Intronic
1051439924 9:17073015-17073037 CTCCACCTGCAGCCCCCGTGCGG + Intergenic
1051449331 9:17178360-17178382 CTCCACCTGCGGCCCGGGTGCGG - Intronic
1051459275 9:17294630-17294652 CTCCACCTGTGGCCCCTGTGCGG - Intronic
1051463869 9:17354348-17354370 CTCCACCTGCAGCCCCGGTGCGG + Intronic
1052056610 9:23914407-23914429 CTCCACCTGCGGCCCCAGTGCGG - Intergenic
1052313491 9:27093023-27093045 CTCCACCTGCAGCCCCGATGGGG + Intergenic
1052979621 9:34438358-34438380 CTCCACCTGCAGCACCGGTGCGG + Intronic
1052985279 9:34482712-34482734 CTTCACCTGCAGCCCCGGTGGGG - Intronic
1053027211 9:34740184-34740206 CTCCACCCGCAGCCCCGGTGCGG - Intergenic
1053547844 9:39042305-39042327 CTCCACCTGCAGCCCCTGTGCGG - Intergenic
1053811968 9:41862346-41862368 CTCCACCTGCAGCCCCGGTGTGG - Intergenic
1054153715 9:61625792-61625814 CTAGACCGGGAGCCCCTGTGGGG - Intergenic
1054618627 9:67325093-67325115 CTCCACCTGCAGCCCCGGTGTGG + Intergenic
1055049432 9:71963950-71963972 CTCCATCTGCAGCCCCGGAGTGG + Intronic
1055102500 9:72480187-72480209 CTCCACCTGCAGCCCTGGTGCGG - Intergenic
1055461393 9:76523676-76523698 CTCCACCTGCAGCCCCTGTGTGG - Intergenic
1055557514 9:77490332-77490354 CTCCACCTGCAACCCCAGTGTGG - Intronic
1055651441 9:78410407-78410429 CTCCACCTGCAGCCCCAGTGCGG + Intergenic
1056672505 9:88642545-88642567 CTCCACCCACAGCCCATCTGTGG + Intergenic
1056736001 9:89209771-89209793 CTCCACCTGCAGCACTGGTGTGG + Intergenic
1056758218 9:89396149-89396171 CTTGACCTGCTGCCCCTGAGTGG + Intronic
1056771325 9:89480366-89480388 CTCCACCTGCAGCCCCGGTGCGG - Intronic
1056776670 9:89518155-89518177 ATGCATCTGCAGCCCCTCTGGGG - Intergenic
1057239603 9:93397052-93397074 CTCCACCCTCAGCCCCTGGCAGG - Intergenic
1057383855 9:94591092-94591114 CTCCACCTGCAGCCCCGGTGCGG - Intronic
1057496487 9:95565195-95565217 GTCCACCTGCAGCGCCTGCATGG + Intergenic
1057511206 9:95680743-95680765 TTCCACCTGCATCCCCCGTGCGG + Intergenic
1057543792 9:96001667-96001689 CTCCACCTGCAGCCCCGGTGCGG - Intronic
1057628561 9:96700836-96700858 CTCCACCTGCAGCCCCGGTGTGG - Intergenic
1057907122 9:98992067-98992089 CTCCACCTGCTGCCCTCGTGCGG - Intronic
1058235627 9:102486931-102486953 CTCCACCTGCAGCCCTGGTATGG - Intergenic
1058286634 9:103187303-103187325 CTCCACCTGCCGCCTGGGTGCGG + Intergenic
1058808271 9:108614254-108614276 CTTCACCTGCCTCACCTGTGTGG - Intergenic
1059791088 9:117642713-117642735 CTCCACCTGCAGCCCCGGTGCGG - Intergenic
1059810684 9:117852397-117852419 CTCAACCTGCAGCCCCGGTGTGG + Intergenic
1059891382 9:118809207-118809229 CTCCACCTGCCGCCCAGGTGCGG - Intergenic
1059991493 9:119870230-119870252 CTCCAACTGCAGCCCCGGTGCGG - Intergenic
1060091412 9:120746757-120746779 CTCCACCTGCAGCCCGGGTGCGG + Intergenic
1060305311 9:122406147-122406169 CTCCACCTGCGGCCCCGCTGCGG - Intergenic
1060340546 9:122771806-122771828 CTCCCCCTGCAGCCCCTGAGAGG - Intergenic
1060594161 9:124838681-124838703 CTCCACCTGCAGCCCTGGTGCGG - Intergenic
1061144669 9:128790727-128790749 GTCCACAGGCATCCCCTGTGAGG + Exonic
1061406272 9:130394544-130394566 CTCCACCCGGAGCACCCGTGTGG - Intronic
1061408493 9:130405608-130405630 CTCCTCTTGGAGCCCCTGTTGGG + Intronic
1061483899 9:130910534-130910556 CTCCACCTGCAGTCCCGGTGCGG + Intronic
1061952569 9:133944552-133944574 CACCACCTGCAGAGCCTGTGAGG + Intronic
1062146141 9:134990980-134991002 CTCCACCTGCAGCCCCAGTGCGG - Intergenic
1062381599 9:136289587-136289609 CCCCTCCTGCAGCCCTTGTGGGG - Intronic
1203785223 EBV:123868-123890 CTCCACCGGTAGCTGCTGTGTGG + Intergenic
1203429863 Un_GL000195v1:80732-80754 CTACACCTGCAGACCCTGTGGGG + Intergenic
1203460366 Un_GL000220v1:30969-30991 CTCCACCTGCGGCCCTGGTGTGG - Intergenic
1203360546 Un_KI270442v1:217077-217099 CTCCCCCCACAGGCCCTGTGTGG - Intergenic
1186152528 X:6690456-6690478 CTCCACCTGCAGCCCCGGTGCGG - Intergenic
1186323185 X:8452439-8452461 CTCCACCTGCAGCCCCGGTGCGG - Intergenic
1186436710 X:9549299-9549321 CTCCACCTCCAGCCTGAGTGAGG + Intronic
1186483743 X:9916920-9916942 TTGCACCTGGAGCCTCTGTGTGG + Intronic
1187005780 X:15231679-15231701 CTCCACCTGCAGCCCTCGTACGG - Intergenic
1187139121 X:16575864-16575886 CTCCACCTGCAGCCCCAGTGCGG + Intergenic
1187275156 X:17810610-17810632 CTCCTCCGGCAGCTCCTGGGAGG - Intronic
1187304672 X:18084215-18084237 CTCCACCTGCAGCCCCAGTGTGG + Intergenic
1187507574 X:19889062-19889084 CTTCAATTGCAGCCTCTGTGTGG - Intergenic
1187557508 X:20366798-20366820 CTCCACCTGCAGCCCCAGTGCGG - Intergenic
1188027493 X:25226043-25226065 CCTCACCTGCAGCAACTGTGTGG + Intergenic
1188166896 X:26873649-26873671 CTCCACCTGCAGCCCCAGTGCGG - Intergenic
1188189593 X:27157415-27157437 CTCCACCTGCAGCCCCAGTGCGG + Intergenic
1188242744 X:27809703-27809725 CTCCACCTGCGGCCCCAGTGCGG + Intronic
1189209901 X:39275992-39276014 CTCCACCTGTGGCCCTGGTGCGG + Intergenic
1190045801 X:47110952-47110974 CTCCACCTGCAGCCCAGGTGCGG - Intergenic
1190329444 X:49226604-49226626 CTCCACCAGCAGCCATGGTGGGG - Exonic
1191136662 X:57070941-57070963 CTCCACCTTCAACCCCTCAGCGG + Intergenic
1191618573 X:63192521-63192543 CTCCACTTGCAGCCCCGATGCGG - Intergenic
1192186820 X:68952526-68952548 CTCCACCTGCAGCCCCAGTGCGG + Intergenic
1192251477 X:69417174-69417196 CTCCACCTGTGGCCCCAGTGCGG + Intergenic
1193040142 X:76996607-76996629 TTCCACCTGCAGCCCCAGTGCGG - Intergenic
1193538092 X:82738152-82738174 CTCCACCTGCAGCCCCGGTGCGG - Intergenic
1193803971 X:85972307-85972329 CTCCACCTGCAGCCCTGGTGCGG - Intronic
1194071536 X:89330978-89331000 CTCCACCTGCAGCCCCAGTGTGG - Intergenic
1194166411 X:90521747-90521769 CTCCACCTGCAGCCCCAGTGCGG + Intergenic
1194384451 X:93236149-93236171 CTCCAACTGCGGCCCCAGTGCGG + Intergenic
1194650754 X:96512200-96512222 CTCCACCTGCAGCCCCGGTGCGG - Intergenic
1195257970 X:103107297-103107319 CTCCACCTGCAGCCCCAGTGTGG - Intergenic
1195341341 X:103909380-103909402 CACCAACTGCAGCCCCTTGGTGG + Intergenic
1195694579 X:107657301-107657323 ACCCACCTGCAGCCCCTGCTGGG - Intergenic
1195896300 X:109749283-109749305 CTCCACCTGCAGCCCCAGTGAGG - Intergenic
1195909539 X:109875843-109875865 CTCCACCAGCGGCTCCTGTGCGG - Intergenic
1196197860 X:112854848-112854870 CTCCACCTGCAGCCCCTGTGCGG - Intergenic
1196582756 X:117395092-117395114 CTCCAACTGCAGCCCCAGTGCGG + Intergenic
1196616219 X:117769445-117769467 CTCCACATGCAGCCCTGGTGCGG + Intergenic
1196662464 X:118282690-118282712 CTCCACCTGCAGCCCCTGTGCGG - Intergenic
1196705842 X:118716885-118716907 CTCCACCTGCAGCCCCAGTGCGG - Intergenic
1196714678 X:118799368-118799390 CTCCACCTGCAGCCCCTGTGCGG + Intergenic
1196728867 X:118921932-118921954 CTCCACCTGCAGTCCCGGTGCGG - Intergenic
1196761910 X:119208421-119208443 CTCCACTTGCAGCCCTGGTGCGG - Intergenic
1196762281 X:119210828-119210850 CTCCACCTGCAGCCCTGGTGCGG - Intergenic
1196771567 X:119300093-119300115 CTCCACCTGCAGCCCTGGTGCGG + Intergenic
1196775269 X:119332286-119332308 CTCCACCTGCAGCCCTGGTGCGG + Intergenic
1196781401 X:119387533-119387555 CTCCACCTGCAGGCCCAGTGCGG - Intergenic
1196793917 X:119487812-119487834 CTCCACCTGCAGCCCCAGTGTGG - Intergenic
1196827203 X:119750770-119750792 CTCCACCTGCGGCCCCAGTGCGG - Intergenic
1196845121 X:119891002-119891024 CTCCACCTGCAGCCCTGGTGTGG + Intergenic
1196860792 X:120025717-120025739 CTCCACCTGCCGCCCAGGTGCGG - Intergenic
1197055487 X:122113767-122113789 CTGCAGCTGCAGCTGCTGTGGGG + Intergenic
1197344765 X:125319011-125319033 CTCCACCTGCAGCCCTGGTGCGG - Intergenic
1197533716 X:127662962-127662984 CTCCACCTGTGGCCCCTGTGCGG - Intergenic
1197978821 X:132194497-132194519 CTCCACCTGCGGCCCCTGTGGGG + Intergenic
1198060981 X:133044791-133044813 CTCCACCTGCAGCCCCAGTGTGG + Intronic
1198574283 X:137992921-137992943 CTTCCCCTGGAGCCCTTGTGTGG - Intergenic
1198694522 X:139321215-139321237 CTCCACCTGCGGCCCCGGTGGGG + Intergenic
1198972523 X:142298194-142298216 CTCCACCTGCAGCCCCTGTGCGG - Intergenic
1199009873 X:142745672-142745694 CTCCACCTGCCACCCCGCTGCGG - Intergenic
1199050168 X:143228640-143228662 CTCCACCTGCAGCCCCTGTGCGG - Intergenic
1199134106 X:144231200-144231222 CTCCACCTGCAGCCTCGGTGCGG - Intergenic
1199175606 X:144784030-144784052 CTCCACCTGCAGCCCCGGTGCGG + Intergenic
1199356178 X:146866831-146866853 CTCCACCTGCAGCCCCTGTGCGG - Intergenic
1200423497 Y:2998324-2998346 CTCCACCTGCAGCCCCGGTGCGG - Intergenic
1200470828 Y:3584039-3584061 CTCCACCTGCAGCCCTGGTGTGG - Intergenic
1200512680 Y:4099528-4099550 CTCCACCTGCAGCCCCGGTGCGG + Intergenic
1200648746 Y:5816186-5816208 CTCCACCCGCGGCCCTGGTGCGG - Intergenic
1200725774 Y:6666707-6666729 CTCCACCTGCAGCCCCAGTGTGG - Intergenic
1200824228 Y:7622165-7622187 CTCCACCTGCAGCCCCGGTGTGG - Intergenic
1200888736 Y:8299028-8299050 CTCCACCTGCAGCCCCGGTGCGG + Intergenic
1201468399 Y:14309655-14309677 CTCCACCTGCGGCCCCAGTGTGG + Intergenic
1201469163 Y:14314862-14314884 CTCCACCTGCAGCCCCAGTGCGG + Intergenic
1201480001 Y:14428502-14428524 CTCCACCTGCAGCCCCGGTGCGG + Intergenic
1201495630 Y:14589732-14589754 CTCCACCTGCAGCCTCGGTGTGG - Intronic
1201496872 Y:14598146-14598168 CTCCACGTGTAGCCCCAGTGCGG - Intronic
1201555330 Y:15260528-15260550 CTCCACCTCTGGCCCCGGTGTGG + Intergenic
1201715874 Y:17043525-17043547 CTCCACCTGCAGCCCCGGTGAGG + Intergenic
1201982556 Y:19923666-19923688 CTCCACCTGCAGCCCTGGTGCGG - Intergenic
1202137025 Y:21676612-21676634 CTCCACCTGCAGCCCCGGTGCGG - Intergenic
1202235826 Y:22708922-22708944 CTCCACCTGCAGCCCCGGTGTGG + Intergenic
1202307337 Y:23487246-23487268 CTCCACCTGCAGCCCCGGTGTGG - Intergenic
1202563468 Y:26183340-26183362 CTCCACCTGCAGCCCCGGTGTGG + Intergenic