ID: 985403799

View in Genome Browser
Species Human (GRCh38)
Location 4:189616617-189616639
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985403792_985403799 11 Left 985403792 4:189616583-189616605 CCCAGTGGATCCCGCACAGGGGC 0: 41
1: 423
2: 623
3: 531
4: 370
Right 985403799 4:189616617-189616639 CTGCCTGCCAGTCCCGCGCCGGG No data
985403793_985403799 10 Left 985403793 4:189616584-189616606 CCAGTGGATCCCGCACAGGGGCT 0: 24
1: 221
2: 409
3: 327
4: 334
Right 985403799 4:189616617-189616639 CTGCCTGCCAGTCCCGCGCCGGG No data
985403787_985403799 25 Left 985403787 4:189616569-189616591 CCCAGCTGGCTTCACCCAGTGGA 0: 849
1: 786
2: 340
3: 179
4: 241
Right 985403799 4:189616617-189616639 CTGCCTGCCAGTCCCGCGCCGGG No data
985403788_985403799 24 Left 985403788 4:189616570-189616592 CCAGCTGGCTTCACCCAGTGGAT 0: 862
1: 802
2: 346
3: 181
4: 237
Right 985403799 4:189616617-189616639 CTGCCTGCCAGTCCCGCGCCGGG No data
985403797_985403799 0 Left 985403797 4:189616594-189616616 CCGCACAGGGGCTGCAGGTGGAG 0: 44
1: 422
2: 402
3: 280
4: 503
Right 985403799 4:189616617-189616639 CTGCCTGCCAGTCCCGCGCCGGG No data
985403796_985403799 1 Left 985403796 4:189616593-189616615 CCCGCACAGGGGCTGCAGGTGGA 0: 40
1: 408
2: 475
3: 344
4: 587
Right 985403799 4:189616617-189616639 CTGCCTGCCAGTCCCGCGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr