ID: 985406295

View in Genome Browser
Species Human (GRCh38)
Location 4:189641900-189641922
Sequence ATCAAGACGCAGAGGAAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985406295_985406299 -9 Left 985406295 4:189641900-189641922 CCTTCCTTCCTCTGCGTCTTGAT No data
Right 985406299 4:189641914-189641936 CGTCTTGATTTCCTCCAAGGTGG No data
985406295_985406300 -6 Left 985406295 4:189641900-189641922 CCTTCCTTCCTCTGCGTCTTGAT No data
Right 985406300 4:189641917-189641939 CTTGATTTCCTCCAAGGTGGTGG No data
985406295_985406303 14 Left 985406295 4:189641900-189641922 CCTTCCTTCCTCTGCGTCTTGAT No data
Right 985406303 4:189641937-189641959 TGGAGACCTCAGTCCTCCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985406295 Original CRISPR ATCAAGACGCAGAGGAAGGA AGG (reversed) Intergenic
No off target data available for this crispr